Stem-loop sequence mml-mir-155

Accession MI0007645
Description Macaca mulatta miR-155 stem-loop
Gene family MIPF0000157; mir-155
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-155. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MiR-155 is a microRNA that in humans is encoded by the MIR155 host gene or MIR155HG. MiR-155 plays an important role in various physiological and pathological processes. Exogenous molecular control in vivo of miR-155 expression may inhibit malignant growth, viral infections, and attenuate the progression of cardiovascular diseases.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
             u    a        uuuac 
cuguuaaugcuaa cgug uagggguu     c
||||||||||||| |||| ||||||||     u
gacaauuacgauu guac auccucag     c
             -    -        ucaac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
3: 21097273-21097337 [-]
intergenic
Database links

Mature sequence mml-miR-155

Accession MIMAT0006216
Sequence

4 - 

uuaaugcuaaucgugauaggggu

 - 26

Get sequence
Evidence by similarity; MI0000681
Predicted targets

References

1