Stem-loop sequence mml-mir-154

AccessionMI0007644
DescriptionMacaca mulatta miR-154 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
ga      u            u      ugcc    - uuu 
  gguacu gaagauagguua ccgugu    uucg c   a
  |||||| |||||||||||| ||||||    |||| |   u
  ccauga uuuuuauccagu ggcaca    aagc g   u
aa      c            u      uacu    a ugu 
Get sequence
Deep sequencing
846 reads, 14.8 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164958168-164958251 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-154
mml-mir-487achr7: 164950883-164950962 [+]
mml-mir-382chr7: 164952738-164952813 [+]
mml-mir-134chr7: 164953119-164953191 [+]
mml-mir-668chr7: 164953688-164953753 [+]
mml-mir-485chr7: 164953852-164953924 [+]
mml-mir-323bchr7: 164954659-164954715 [+]
mml-mir-154chr7: 164958168-164958251 [+]
mml-mir-496chr7: 164959019-164959120 [+]
mml-mir-377chr7: 164960414-164960482 [+]
mml-mir-541chr7: 164962858-164962941 [+]
mml-mir-409chr7: 164963666-164963744 [+]
mml-mir-412chr7: 164963813-164963903 [+]
mml-mir-369chr7: 164963963-164964032 [+]
mml-mir-410chr7: 164964276-164964355 [+]
mml-mir-656chr7: 164965089-164965166 [+]
Database links

Mature sequence mml-miR-154-5p

Accession MIMAT0006215
Sequence

15 - 

uagguuauccguguugccuucg

 - 36

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-154-3p

Accession MIMAT0026830
Sequence

51 - 

aaucauacacgguugaccuauu

 - 72

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).