Stem-loop sequence mml-mir-152

AccessionMI0007643 (change log)
DescriptionMacaca mulatta miR-152 stem-loop
Gene family MIPF0000056; mir-148
Literature search

1 open access papers mention mml-mir-152
(4 sentences)

Stem-loop
   u    cc  c              g  a    cc    cgg   c 
5'  gucc  cc ggcccagguucugu au cacu  gacu   gcu u
    ||||  || |||||||||||||| || ||||  ||||   |||  
3'  cagg  gg ccggguucaagaca ua guga  cuga   cga g
   c    aa  c              g  c    --    ---   g 
Get sequence
Deep sequencing
159197 reads, 1.26e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 41870677-41870763 [+]
intergenic
Database links

Mature sequence mml-miR-152-5p

Accession MIMAT0026829
Sequence

16 - 

agguucugugauacacuccgacu

 - 38

Get sequence
Deep sequencing337 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-152-3p

Accession MIMAT0006214
Sequence

54 - 

ucagugcaugacagaacuugg

 - 74

Get sequence
Deep sequencing158855 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).