Stem-loop sequence mml-mir-151

Accession MI0007642
Description Macaca mulatta miR-151 stem-loop
Gene family MIPF0000057; mir-28
Stem-loop
   ---------------u      c            ca          u ucu 
5'                 uuccug ccucgaggagcu  cagucuagua g   c
                   |||||| ||||||||||||  |||||||||| |    
3'                 agggac ggaguuccucga  gucagaucau c   a
   cuccacucauacuggu      a            -a          c ccu 
Get sequence
Deep sequencing
201786 reads, 6.3e+03 reads per million, 8 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr8: 145668622-145668711 [-]
intergenic
Database links

Mature sequence mml-miR-151-5p

Accession MIMAT0006212
Sequence

11 - 

ucgaggagcucacagucuagu

 - 31

Get sequence
Deep sequencing 383 reads, 8 experiments
Evidence by similarity; MI0000809
Predicted targets

Mature sequence mml-miR-151-3p

Accession MIMAT0006213
Sequence

47 - 

cuagacugaagcuccuugagg

 - 67

Get sequence
Deep sequencing 1228 reads, 8 experiments
Evidence by similarity; MI0000809
Predicted targets

References

1