Stem-loop sequence mml-mir-151

AccessionMI0007642 (change log)
DescriptionMacaca mulatta miR-151 stem-loop
Gene family MIPF0000057; mir-28
Stem-loop
   ---------------u      c            ca          u ucu 
5'                 uuccug ccucgaggagcu  cagucuagua g   c
                   |||||| ||||||||||||  |||||||||| |    
3'                 agggac ggaguuccucga  gucagaucau c   a
   cuccacucauacuggu      a            -a          c ccu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr8: 139957629-139957718 [-]
intergenic
Database links

Mature sequence mml-miR-151-5p

Accession MIMAT0006212
Sequence

11 - 

ucgaggagcucacagucuagu

 - 31

Get sequence
Evidence by similarity; MI0000809
Database links
Predicted targets

Mature sequence mml-miR-151-3p

Accession MIMAT0006213
Sequence

47 - 

cuagacugaagcuccuugagg

 - 67

Get sequence
Evidence by similarity; MI0000809
Database links
Predicted targets

References

1