Stem-loop sequence mml-mir-151

Accession MI0007642
Description Macaca mulatta miR-151 stem-loop
Gene family MIPF0000057; mir-28
Stem-loop
---------------u      c            ca          u ucu 
                uuccug ccucgaggagcu  cagucuagua g   c
                |||||| ||||||||||||  |||||||||| |    
                agggac ggaguuccucga  gucagaucau c   a
cuccacucauacuggu      a            -a          c ccu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
8: 143221103-143221192 [-]
intergenic
Database links

Mature sequence mml-miR-151-5p

Accession MIMAT0006212
Sequence

11 - 

ucgaggagcucacagucuagu

 - 31

Get sequence
Evidence by similarity; MI0000809
Predicted targets

Mature sequence mml-miR-151-3p

Accession MIMAT0006213
Sequence

47 - 

cuagacugaagcuccuugagg

 - 67

Get sequence
Evidence by similarity; MI0000809
Predicted targets

References

1