Stem-loop sequence mml-mir-150

AccessionMI0007641 (change log)
DescriptionMacaca mulatta miR-150 stem-loop
Gene family MIPF0000197; mir-150
Literature search

2 open access papers mention mml-mir-150
(4 sentences)

Stem-loop
   c      u  -            ac   u       u -   g 
5'  ucccca gg cccugucuccca  ccu guaccag g cug g
    |||||| || ||||||||||||  ||| ||||||| | |||  
3'  aggggu cc gggacagggggu  gga caugguc c gac c
   c      -  a            cc   -       c a   u 
Get sequence
Deep sequencing
4088 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 44889216-44889299 [-]
intergenic
Database links

Mature sequence mml-miR-150-5p

Accession MIMAT0006211
Sequence

16 - 

ucucccaacccuuguaccagug

 - 37

Get sequence
Deep sequencing4000 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-150-3p

Accession MIMAT0026828
Sequence

51 - 

cugguacaggccugggggaca

 - 71

Get sequence
Deep sequencing84 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).