Stem-loop sequence mml-mir-150

Accession MI0007641
Description Macaca mulatta miR-150 stem-loop
Gene family MIPF0000197; mir-150
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-150. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-150 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-150 functions in hematopoiesis; it regulates genes whose downstream products encourage differentiating stem cells towards becoming megakaryocytes rather than erythrocytes. It is also thought to control B and T cell differentiation, alongside mir-155.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c      u  -            ac   u       u -   g 
 ucccca gg cccugucuccca  ccu guaccag g cug g
 |||||| || ||||||||||||  ||| ||||||| | |||  
 aggggu cc gggacagggggu  gga caugguc c gac c
c      -  a            cc   -       c a   u 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 55765048-55765131 [-]
antisense
Database links

Mature sequence mml-miR-150

Accession MIMAT0006211
Sequence

16 - 

ucucccaacccuuguaccagug

 - 37

Get sequence
Evidence by similarity; MI0000479
Predicted targets

References

1