Stem-loop sequence mml-mir-149

AccessionMI0007640 (change log)
DescriptionMacaca mulatta miR-149 stem-loop
Gene family MIPF0000274; mir-149
Literature search

2 open access papers mention mml-mir-149
(24 sentences)

Stem-loop
   g     -    a   u u g      g     a     g g   g 
5'  ccggc gccc agc c g cuccgu ucuuc cuccc u uuu u
    ||||| |||| ||| | | |||||| ||||| ||||| | |||  
3'  ggccg cggg ucg g c ggggca ggagg gaggg a gag c
   a     a    g   u u g      g     -     - g   c 
Get sequence
Deep sequencing
121461 reads, 567 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr12: 123188632-123188720 [+]
intergenic
Database links

Mature sequence mml-miR-149-5p

Accession MIMAT0006210
Sequence

15 - 

ucuggcuccgugucuucacuccc

 - 37

Get sequence
Deep sequencing120945 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-149-3p

Accession MIMAT0026827
Sequence

55 - 

gagggagggacgggggcugugc

 - 76

Get sequence
Deep sequencing449 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).