Stem-loop sequence mml-mir-148b

AccessionMI0007639 (change log)
DescriptionMacaca mulatta miR-148b stem-loop
Gene family MIPF0000056; mir-148
Stem-loop
   caagcac  uu   a       ug         u  a    ca    gugg u 
5'        ga  agc uuugagg  aaguucugu au cacu  ggcu    c c
          ||  ||| |||||||  ||||||||| || ||||  ||||    | u
3'        cu  ucg aagcucu  uucaagaca ua guga  cuga    g c
   -----au  -u   a       gu         c  c    --    --aa u 
Get sequence
Deep sequencing
244632 reads, 1.79e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr11: 53018095-53018193 [+]
sense
ENSMMUT00000000156 ; NCKAP1L-202; intron 14
ENSMMUT00000000158 ; NCKAP1L-201; intron 25
Database links

Mature sequence mml-miR-148b-5p

Accession MIMAT0026826
Sequence

24 - 

gaaguucuguuauacacucaggcu

 - 47

Get sequence
Deep sequencing12977 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-148b-3p

Accession MIMAT0006209
Sequence

63 - 

ucagugcaucacagaacuuugu

 - 84

Get sequence
Deep sequencing231654 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).