Stem-loop sequence mml-mir-148a

AccessionMI0007638 (change log)
DescriptionMacaca mulatta miR-148a stem-loop
Gene family MIPF0000056; mir-148
Stem-loop
                 -  -a    cc    -   ag 
5' gaggcaaaguucug ag  cacu  gacu cug  u
   |||||||||||||| ||  ||||  |||| |||  a
3' cucuguuucaagac uc  guga  cuga gau  u
                 a  ac    --    a   ag 
Get sequence
Deep sequencing
571043 reads, 4.52e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 82255603-82255670 [+]
intergenic
Database links

Mature sequence mml-miR-148a-5p

Accession MIMAT0026825
Sequence

6 - 

aaaguucugagacacuccgacu

 - 27

Get sequence
Deep sequencing3541 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-148a-3p

Accession MIMAT0006208
Sequence

44 - 

ucagugcacuacagaacuuugu

 - 65

Get sequence
Deep sequencing567495 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).