|
miRBase |
|
Stem-loop sequence mml-mir-147b |
|||||||
| Accession | MI0007637 | ||||||
| Description | Macaca mulatta miR-147b stem-loop | ||||||
| Gene family | MIPF0000105; mir-147 | ||||||
| Stem-loop |
-- u c ug a aacuagauu ua aaau uag gaa cauuuccgcaca cugga || |||| ||| ||| |||||||||||| |||| c au uuua guc cuu gugaaggcgugu gacca gg u c gu c --------- |
||||||
| Genome context |
|
||||||
| Database links |
|
||||||
Mature sequence mml-miR-147b |
|
| Accession | MIMAT0006207 |
| Sequence |
49 - gugugcggaagugcuucugcu - 69 |
| Evidence | by similarity; MI0005544 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|