Stem-loop sequence mml-mir-147b

Accession MI0007637
Description Macaca mulatta miR-147b stem-loop
Gene family MIPF0000105; mir-147
Stem-loop
   --  u    c   ug   a            aacuagauu      
5'   ua aaau uag  gaa cauuuccgcaca         cugga 
     || |||| |||  ||| ||||||||||||         |||| c
3'   au uuua guc  cuu gugaaggcgugu         gacca 
   gg  u    c   gu   c            ---------      
Get sequence
Deep sequencing
43 reads, 8.56 reads per million, 6 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 22610603-22610682 [+]
intergenic
Database links

Mature sequence mml-miR-147b

Accession MIMAT0006207
Sequence

49 - 

gugugcggaagugcuucugcu

 - 69

Get sequence
Evidence by similarity; MI0005544
Predicted targets

References

1