Stem-loop sequence mml-mir-147a

AccessionMI0007636
DescriptionMacaca mulatta miR-147a stem-loop
Gene family MIPF0000105; mir-147
Stem-loop
-aaucuaa    aa      ug     acaccagac 
        agaa  cauuuc  cacac         u
        ||||  ||||||  |||||          
        ucuu  guaaag  gugug         a
uuacaucg    -c      gu     accgaaguu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr15: 15663929-15664000 [+]
intergenic
Database links

Mature sequence mml-miR-147a

Accession MIMAT0006206
Sequence

47 - 

guguguggaaaugcuucugcua

 - 68

Get sequence
Evidence by similarity; MI0000262
Predicted targets

References

1