|
miRBase |
|
Stem-loop sequence mml-mir-147a |
|||||
| Accession | MI0007636 | ||||
| Description | Macaca mulatta miR-147a stem-loop | ||||
| Gene family | MIPF0000105; mir-147 | ||||
| Stem-loop |
-aaucuaa aa ug acaccagac
agaa cauuuc cacac u
|||| |||||| |||||
ucuu guaaag gugug a
uuacaucg -c gu accgaaguu
|
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence mml-miR-147a |
|
| Accession | MIMAT0006206 |
| Sequence |
47 - guguguggaaaugcuucugcua - 68 |
| Evidence | by similarity; MI0000262 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|