Stem-loop sequence mml-mir-146b

AccessionMI0007635 (change log)
DescriptionMacaca mulatta miR-146b stem-loop
Gene family MIPF0000103; mir-146
Literature search

2 open access papers mention mml-mir-146b
(4 sentences)

Stem-loop
     u      g        au        cu  ga  u 
5' cc ggcacu agaacuga  uccauagg  gu  gc c
   || |||||| ||||||||  ||||||||  ||  ||  
3' gg ccgugg ucuugacu  agguaucc  ua  cg u
     c      -        -c        cg  aa  a 
Get sequence
Deep sequencing
1319192 reads, 1e+04 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr9: 98154421-98154494 [+]
intergenic
Database links

Mature sequence mml-miR-146b-5p

Accession MIMAT0006204
Sequence

9 - 

ugagaacugaauuccauaggcu

 - 30

Get sequence
Deep sequencing1317551 reads, 9 experiments
Evidence by similarity; MI0003129
Database links
Predicted targets

Mature sequence mml-miR-146b-3p

Accession MIMAT0006205
Sequence

45 - 

augcccuauggacucaguucug

 - 66

Get sequence
Deep sequencing1641 reads, 9 experiments
Evidence by similarity; MI0003129
Predicted targets

References

1