Stem-loop sequence mml-mir-146a

AccessionMI0007634 (change log)
DescriptionMacaca mulatta miR-146a stem-loop
Gene family MIPF0000103; mir-146
Literature search

3 open access papers mention mml-mir-146a
(4 sentences)

Stem-loop
   -----ccuaugu      u     uu            c        g  uc 
5'             guaucc cagcu  gagaacugaauu cauggguu ug  a
               |||||| |||||  |||||||||||| |||||||| ||  g
3'             uauagg gucga  uucuugacuuaa guguccag ac  u
   ugcugcugucuc      -     -c            a        -  ug 
Get sequence
Deep sequencing
1221888 reads, 9.74e+03 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr6: 158689083-158689181 [+]
sense
ENSMMUT00000013556 ; GABRG2-201; intron 4
ENSMMUT00000013555 ; GABRG2-202; intron 4
Database links

Mature sequence mml-miR-146a-5p

Accession MIMAT0006203
Sequence

21 - 

ugagaacugaauuccauggguu

 - 42

Get sequence
Deep sequencing1221875 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-146a-3p

Accession MIMAT0026824
Sequence

57 - 

ccugugaaauucaguucuucag

 - 78

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).