Stem-loop sequence mml-mir-143

Accession MI0007632
Description Macaca mulatta miR-143 stem-loop
Gene family MIPF0000094; mir-143
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-143. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-143 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by a several mechanisms. mir–143 is highly conserved in vertebrates. mir-143 is thought be involved in cardiac morphogenesis but has also been implicated in cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-gc    c  cgug    c ag      g         g      u  -  ag 
   gcag gc    ucuc c  ccugag ugcagugcu caucuc gg uc  u
   |||| ||    |||| |  |||||| ||||||||| |||||| || ||   
   cguc ug    agag g  ggacuc augucacga guagag cu ag  u
cga    u  uuga    a aa      g         a      u  g  gg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
6: 145901872-145901977 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-143
mml-mir-143 6: 145901872-145901977 [+]
mml-mir-145 6: 145903531-145903618 [+]
Database links

Mature sequence mml-miR-143-5p

Accession MIMAT0026823
Sequence

28 - 

gugcagugcugcaucucugg

 - 47

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-143-3p

Accession MIMAT0006201
Sequence

61 - 

ugagaugaagcacuguagcuc

 - 81

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).