miRNA Entry for MI0007632

Description

Macaca mulatta miR-143 stem-loop

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-143. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-143 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by a several mechanisms. mir–143 is highly conserved in vertebrates. mir-143 is thought be involved in cardiac morphogenesis but has also been implicated in cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry

mir-143

miR-143 microRNA secondary structure and sequence conservation
Identifiers
Symbol	mir-143
Rfam	RF00683
miRBase family	MIPF0000094
Entrez	406935
HUGO	31530
OMIM	612117
Other data
RNA type	microRNA
Domain(s)	Eukaryota; Vertebrata

In molecular biology mir-143 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by a several mechanisms. mir–143 is highly conserved in vertebrates.^[1] mir-143 is thought be involved in cardiac morphogenesis but has also been implicated in cancer.

[edit] Genomic location

mir– 143 is located on chromosome 5 position 33 in the human genome.^[1] mir-143 is located very close to mir-145 in the genome and it is speculated that they are transcribed as a bicistronic unit.^[2] Their co-transcription means they are frequently studied together in the same cellular pathways and diseases.

[edit] Expression

mir–143 is a direct transcriptional target of the serum response factor, myocardin and nkx2-5.^[2] mir-143 expression is also thought to be controlled epigenetically through heart beat.^[3]

[edit] Targets

These are known genetic targets for mir–143 and its effect on them:

Klf4 - Promotes transcription.^[2]
ELK1 – Promotes transcription.^[2]
ADD3 – Represses transcription. F-actin capping protein.^[4]
FNDC38 – Represses transcription. Tumour metastasis.^[5]
Raldh2/aldh1a2 - Represses transcription. Involved in heart tube organization.^[3]
rxrab – Represses transcription. Involved in heart tube organization.^[3]
KLF5 – Unknown has conserved miR – 143 binding site.^[1]
MAP3K7– Unknown has conserved miR – 143 binding site.^[1]
TARDBP – Unknown has conserved miR – 143 binding site.^[1]
UBE2E3– Unknown has conserved miR – 143 binding site.^[1]

[edit] Cardiogenesis

mir-143 is thought to play an important role in cardiac morphogenesis. mir–143 was found to be the most enriched miRNA in mouse embryonic stem cells that were differentiating into cardiac progenitor cells.^[2] It is a direct transcriptional target of serum response factor, myocardin and nkx2-5.^[2] Research has shown that mir-143 plays an important role in smooth muscle cell fate. It is co-transcribed with miR-145 in cardiac progenitors before becoming vascular smooth muscle cells (VSMCs). VSMCs are unusual in the fact that they can switch between a proliferative or a quiescent more differentiated state. Along with mir–145, mir- 143 has been shown to target a network of transcription factors (including klf4 and elk-1) that promote differentiation and repress the proliferation of VSMCs.^[2] MiR-143 has also been implicated in the more general morphogenesis of the heart. In zebrafish it was shown that mir-143 is required for chamber morphogenesis through repression of add3. A knockout resulted in ventricular collapse.^[4] It has also been suggested that mir-143 expression may be controlled by heart beat. In zebrafish mir-143 expression was absent when heartbeat was arrested and restored when heartbeat was reinitiated.^[3] Understanding mir– 143 may be important for understanding vascular disease. The plasticity of VSMCs is thought to be the basis of many human vascular diseases such as atherosclerosis.^[2]It has also been shown that in human aortic aneurysms the expression of mir-143 and mir-145 were found to be significantly decreased when compared to controls.^[6]

[edit] Cancer

Changes in mir-145 expression have frequently been implicated in cancer. However the exact nature of this relationship is not fully understood. The up-regulation of mir-143 was observed in a hepatocellular carcinoma model during tumor metastasis through repression of FNDC38.^[5] However decreased expression of mir-143 and 145 have been observed in cancer samples. Expression was shown to be decreased in a range of cancer stages, including in very early samples. This suggests that they are involved in tumorgenesis.^[7] A modified version of mir-143 (mir-143BP) with greater activity and resistance to nuclease was shown to have a tumor-suppressive effect on colorectal cancer cells. This makes miR-143 a candidate for RNA medicine for treatment of tumors.^[7]

[edit] References

^ ^a ^b ^c ^d ^e ^f ^g Trakooljul N, Hicks JA, Liu HC (2010). "Identification of target genes and pathways associated with chicken microRNA miR-143.". Anim Genet 41 (4): 357–64. doi:10.1111/j.1365-2052.2009.02015.x. PMID 20064147.
^ ^a ^b ^c ^d ^e ^f ^g ^h ⁱ Cordes KR, Sheehy NT, White MP, Berry EC, Morton SU, Muth AN, Lee TH, Miano JM, Ivey KN, Srivastava D (2009). "miR-145 and miR-143 regulate smooth muscle cell fate and plasticity". Nature 460 (7256): 705–10. doi:10.1038/nature08195. PMC 2769203. PMID 19578358. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2769203.
^ ^a ^b ^c ^d ^e Miyasaka KY, Kida YS, Banjo T, Ueki Y, Nagayama K, Matsumoto T, Sato M, Ogura T (2010). "Heartbeat regulates cardiogenesis by suppressing retinoic acid signaling via expression of miR-143". Mech Dev 128 (1–2): 18–28. doi:10.1016/j.mod.2010.09.002. PMID 20869435.
^ ^a ^b ^c Deacon DC, Nevis KR, Cashman TJ, Zhou Y, Zhao L, Washko D, Guner-Ataman B, Burns CG, Burns CE (2010). "The miR-143-adducin3 pathway is essential for cardiac chamber morphogenesis". Development 137 (11): 1887–96. doi:10.1242/dev.050526. PMID 20460367.
^ ^a ^b ^c Zhang H, Cai X, Wang Y, Tang H, Tong D, Ji F (2010). "microRNA-143, down-regulated in osteosarcoma, promotes apoptosis and suppresses tumorigenicity by targeting Bcl-2". Oncol Rep 24 (5): 1363–9. PMID 20878132.
^ ^a ^b Elia L, Quintavalle M, Zhang J, Contu R, Cossu L, Latronico MV, Peterson KL, Indolfi C, Catalucci D, Chen J, Courtneidge SA, Condorelli G (2009). "The knockout of miR-143 and -145 alters smooth muscle cell maintenance and vascular homeostasis in mice: correlates with human disease". Cell Death Differ 16 (12): 1590–8. doi:10.1038/cdd.2009.153. PMC 3014107. PMID 19816508. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3014107.
^ ^a ^b ^c Kitade Y, Akao Y (2010). "MicroRNAs and Their Therapeutic Potential for Human Diseases: MicroRNAs, miR-143 and -145, Function as Anti-oncomirs and the Application of Chemically Modified miR-143 as an Anti-cancer Drug". J Pharmacol Sci 114 (3): 276–80. PMID 20953119.

[edit] Further reading

Kulda V, Pesta M, Topolcan O, Liska V, Treska V, Sutnar A, Rupert K, Ludvikova M, Babuska V, Holubec L, Cerny R (2010). "Relevance of miR-21 and miR-143 expression in tissue samples of colorectal carcinoma and its liver metastases". Cancer Genet Cytogenet 200 (2): 154–60. doi:10.1016/j.cancergencyto.2010.04.015. PMID 20620599.
Yang Y, Chaerkady R, Kandasamy K, Huang TC, Selvan LD, Dwivedi SB, Kent OA, Mendell JT, Pandey A (2010). "Identifying targets of miR-143 using a SILAC-based proteomic approach". Mol Biosyst 6 (10): 1873–82. doi:10.1039/c004401f. PMID 20544124.
Iio A, Nakagawa Y, Hirata I, Naoe T, Akao Y (2010). "Identification of non-coding RNAs embracing microRNA-143/145 cluster". Mol Cancer 9: 136. doi:10.1186/1476-4598-9-136. PMC 2903500. PMID 20525177. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2903500.
Wang X, Hu G, Zhou J (2010). "Repression of versican expression by microRNA-143". J Biol Chem 285 (30): 23241–50. doi:10.1074/jbc.M109.084673. PMC 2906317. PMID 20489207. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2906317.
Gao W, Yu Y, Cao H, Shen H, Li X, Pan S, Shu Y (2010). "Deregulated expression of miR-21, miR-143 and miR-181a in non small cell lung cancer is related to clinicopathologic characteristics or patient prognosis". Biomed Pharmacother 64 (6): 399–408. doi:10.1016/j.biopha.2010.01.018. PMID 20363096.
Akao Y, Nakagawa Y, Hirata I, Iio A, Itoh T, Kojima K, Nakashima R, Kitade Y, Naoe T (2010). "Role of anti-oncomirs miR-143 and -145 in human colorectal tumors". Cancer Gene Ther 17 (6): 398–408. doi:10.1038/cgt.2009.88. PMID 20094072.
ClapÃ© C, Fritz V, Henriquet C, Apparailly F, Fernandez PL, Iborra F, AvancÃ¨s C, Villalba M, Culine S, Fajas L (2009). Creighton, Chad. ed. "miR-143 interferes with ERK5 signaling, and abrogates prostate cancer progression in mice". PLoS ONE 4 (10): e7542. doi:10.1371/journal.pone.0007542. PMC 2763222. PMID 19855844. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2763222.
Borralho PM, Kren BT, Castro RE, da Silva IB, Steer CJ, Rodrigues CM (2009). "MicroRNA-143 reduces viability and increases sensitivity to 5-fluorouracil in HCT116 human colorectal cancer cells". FEBS J 276 (22): 6689–700. doi:10.1111/j.1742-4658.2009.07383.x. PMID 19843160.
Xin M, Small EM, Sutherland LB, Qi X, McAnally J, Plato CF, Richardson JA, Bassel-Duby R, Olson EN (2009). "MicroRNAs miR-143 and miR-145 modulate cytoskeletal dynamics and responsiveness of smooth muscle cells to injury". Genes Dev 23 (18): 2166–78. doi:10.1101/gad.1842409. PMC 2751981. PMID 19720868. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2751981.
Zhang R, Wang L, Yang AG (2009). "Is microRNA-143 really a turncoat of tumor suppressor microRNA in hepatitis B virus-related hepatocellular carcinoma?". Hepatology 50 (3): 987; author reply 987–8. doi:10.1002/hep.23124. PMID 19670426.
Ng EK, Tsang WP, Ng SS, Jin HC, Yu J, Li JJ, RÃ¶cken C, Ebert MP, Kwok TT, Sung JJ (2009). "MicroRNA-143 targets DNA methyltransferases 3A in colorectal cancer". Br J Cancer 101 (4): 699–706. doi:10.1038/sj.bjc.6605195. PMC 2736825. PMID 19638978. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2736825.
Zhang X, Liu S, Hu T, Liu S, He Y, Sun S (2009). "Up-regulated microRNA-143 transcribed by nuclear factor kappa B enhances hepatocarcinoma metastasis by repressing fibronectin expression". Hepatology 50 (2): 490–9. doi:10.1002/hep.23008. PMID 19472311.
Akao Y, Nakagawa Y, Iio A, Naoe T (2009). "Role of microRNA-143 in Fas-mediated apoptosis in human T-cell leukemia Jurkat cells". Leuk Res 33 (11): 1530–8. doi:10.1016/j.leukres.2009.04.019. PMID 19464056.

[edit] External links

Rfam page for mir-143 microRNA precursor family

v t e miRNA precursor families

1-100	1 · 2 · 6 · 7 · 8/141/200 · 9/79 · 10 · 15 · 16 · 17 · 19 · 21 · 22 · 24 · 26 · 29 · 30 · 31 · 33 · 34 · 46/47/281 · 92 · 96

101-200	101 · 103/107 · 122 · 124 · 126 · 127 · 129 · 130 · 132 · 133 · 134 · 135 · 137 · 138 · 143 · 144 · 145 · 146 · 148/152 · 150 · 155 · 156 · 160 · 166 · 172 · 181 · 184 · 191 · 192/215 · 194 · 196 · 199 · 200

201+	203 · 205 · 208 · 210 · 214 · 218 · 219 · 221 · 223 · 224 · 296 · 338 · 395 · 399 · 433 · 451

Other	BART1 · BART2 · BHRF1-1 · BHRF1-2 · BHRF1-3 · Let-7 · Lin-4

Genome context

Coordinates (MMUL1.0)	Overlapping transcripts
6: 145901872-145901977 [+]	intergenic

Database links

ENTREZGENE: 100315513;MIR143

Mature sequence mml-miR-143
Accession	MIMAT0006201
Sequence	61 - ugagaugaagcacuguagcuc - 81 Get sequence
Evidence	by similarity; MI0000459
Predicted targets	TARGETSCAN-VERT:mml-miR-143

miRBase

Stem-loop sequence mml-mir-143

Contents