Stem-loop sequence mml-mir-142

AccessionMI0007631 (change log)
DescriptionMacaca mulatta miR-142 stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
   g        g   c           a         uaa ag a 
5'  acagugca uca ccauaaaguag aagcacuac   c  c c
    |||||||| ||| ||||||||||| |||||||||   |  |  
3'  ugucaugu agu gguauuucauc uuugugaug   g  g u
   g        g   a           c         -ug ga g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 31321566-31321652 [+]
antisense
ENSMMUT00000010123 ; INTS2-201; intron 9
Database links

Mature sequence mml-miR-142-5p

Accession MIMAT0006199
Sequence

16 - 

cauaaaguagaaagcacuacu

 - 36

Get sequence
Evidence by similarity; MI0000458
Database links
Predicted targets

Mature sequence mml-miR-142-3p

Accession MIMAT0006200
Sequence

52 - 

uguaguguuuccuacuuuaugga

 - 74

Get sequence
Evidence by similarity; MI0000458
Database links
Predicted targets

References

1