Stem-loop sequence mml-mir-142

Accession MI0007631
Description Macaca mulatta miR-142 stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
g        g   c           a         uaa ag a 
 acagugca uca ccauaaaguag aagcacuac   c  c c
 |||||||| ||| ||||||||||| |||||||||   |  |  
 ugucaugu agu gguauuucauc uuugugaug   g  g u
g        g   a           c         -ug ga g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
16: 42574680-42574766 [-]
intergenic
Database links

Mature sequence mml-miR-142-5p

Accession MIMAT0006199
Sequence

16 - 

cauaaaguagaaagcacuacu

 - 36

Get sequence
Evidence by similarity; MI0000458
Predicted targets

Mature sequence mml-miR-142-3p

Accession MIMAT0006200
Sequence

52 - 

uguaguguuuccuacuuuaugga

 - 74

Get sequence
Evidence by similarity; MI0000458
Predicted targets

References

1