Stem-loop sequence mml-mir-142

Accession MI0007631
Description Macaca mulatta miR-142 stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
   g        g   c           a         uaa ag a 
5'  acagugca uca ccauaaaguag aagcacuac   c  c c
    |||||||| ||| ||||||||||| |||||||||   |  |  
3'  ugucaugu agu gguauuucauc uuugugaug   g  g u
   g        g   a           c         -ug ga g 
Get sequence
Deep sequencing
29431 reads, 579 reads per million, 8 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr16: 44581284-44581370 [-]
antisense
ENSMMUT00000010123 ; INTS2-201; intron 9
Database links

Mature sequence mml-miR-142-5p

Accession MIMAT0006199
Sequence

16 - 

cauaaaguagaaagcacuacu

 - 36

Get sequence
Deep sequencing 26 reads, 7 experiments
Evidence by similarity; MI0000458
Predicted targets

Mature sequence mml-miR-142-3p

Accession MIMAT0006200
Sequence

52 - 

uguaguguuuccuacuuuaugga

 - 74

Get sequence
Deep sequencing 626 reads, 8 experiments
Evidence by similarity; MI0000458
Predicted targets

References

1