Stem-loop sequence mml-mir-139

Accession MI0007629
Description Macaca mulatta miR-139 stem-loop
Gene family MIPF0000117; mir-139
Stem-loop
   gug       -   u  a            g gg 
5'    uauucua cag gc cgugucuccagu u  c
      ||||||| ||| || |||||||||||| |  u
3'    augaggu guc cg gcgcagaggucg a  c
   -ca       u   c  -            g gg 
Get sequence
Deep sequencing
37829 reads, 543 reads per million, 8 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr14: 71024400-71024467 [-]
sense
ENSMMUT00000001834 ; FCHSD2-201; intron 7
Database links

Mature sequence mml-miR-139-5p

Accession MIMAT0006195
Sequence

7 - 

ucuacagugcacgugucuccag

 - 28

Get sequence
Deep sequencing 86 reads, 4 experiments
Evidence by similarity; MI0000261
Predicted targets

Mature sequence mml-miR-139-3p

Accession MIMAT0006196
Sequence

44 - 

ggagacgcggcccuguuggagu

 - 65

Get sequence
Deep sequencing 27 reads, 3 experiments
Evidence by similarity; MI0000261
Predicted targets

References

1