Stem-loop sequence mml-mir-139

Accession MI0007629
Description Macaca mulatta miR-139 stem-loop
Gene family MIPF0000117; mir-139
Stem-loop
gug       -   u  a            g gg 
   uauucua cag gc cgugucuccagu u  c
   ||||||| ||| || |||||||||||| |  u
   augaggu guc cg gcgcagaggucg a  c
-ca       u   c  -            g gg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
14: 70701137-70701204 [-]
intergenic
Database links

Mature sequence mml-miR-139-5p

Accession MIMAT0006195
Sequence

7 - 

ucuacagugcacgugucuccag

 - 28

Get sequence
Evidence by similarity; MI0000261
Predicted targets

Mature sequence mml-miR-139-3p

Accession MIMAT0006196
Sequence

44 - 

ggagacgcggcccuguuggagu

 - 65

Get sequence
Evidence by similarity; MI0000261
Predicted targets

References

1