Stem-loop sequence mml-mir-137

AccessionMI0007627 (change log)
DescriptionMacaca mulatta miR-137 stem-loop
Gene family MIPF0000106; mir-137
Stem-loop
   g u  u   --           ug   g           ug a     -  g 
5'  g cc cug  acucucuucgg  acg guauucuuggg  g uaaua cg a
    | || |||  |||||||||||  ||| |||||||||||  | ||||| || u
3'  c gg gac  ugagaggagcu  ugc cauaagaauuc  u auugu gc u
   a -  c   ca           ga   g           gu -     u  a 
Get sequence
Deep sequencing
75100 reads, 333 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 98853607-98853708 [-]
antisense
ENSMMUT00000011904 ; SNX7-202; intron 6
ENSMMUT00000011902 ; SNX7-201; intron 7
Database links

Mature sequence mml-miR-137-5p

Accession MIMAT0026821
Sequence

23 - 

acggguauucuuggguggauaaua

 - 46

Get sequence
Deep sequencing104 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-137-3p

Accession MIMAT0006193
Sequence

59 - 

uuauugcuuaagaauacgcguag

 - 81

Get sequence
Deep sequencing74987 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).