Stem-loop sequence mml-mir-137

Accession MI0007627
Description Macaca mulatta miR-137 stem-loop
Gene family MIPF0000106; mir-137
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-137. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-137 (or microRNA-137) is a short non-coding RNA molecule that functions to regulate the expression levels of other genes by various mechanisms. miR-137 is located on human chromosome 1p22 and has been implicated to act as a tumor suppressor in several cancer types including colorectal cancer, squamous cell carcinoma and melanoma via cell cycle control. miR-137 has also been shown to regulate dendritic development and maturation of neurons. miR-137 belongs to the miR-137 clan (a clan is group of two or more RNA families that have arisen from a single evolutionary origin, as derived from their related structure and function). The miR-137 clan contains two members: miR-137 and miR-234; the total number of RNA domains in the clan is 112.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
g u  u   --           ug   g           ug a     -  g 
 g cc cug  acucucuucgg  acg guauucuuggg  g uaaua cg a
 | || |||  |||||||||||  ||| |||||||||||  | ||||| || u
 c gg gac  ugagaggagcu  ugc cauaagaauuc  u auugu gc u
a -  c   ca           ga   g           gu -     u  a 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
1: 101111773-101111874 [-]
intergenic
Database links

Mature sequence mml-miR-137

Accession MIMAT0006193
Sequence

59 - 

uuauugcuuaagaauacgcguag

 - 81

Get sequence
Evidence by similarity; MI0000454
Predicted targets

References

1