Stem-loop sequence mml-mir-136

AccessionMI0007626 (change log)
DescriptionMacaca mulatta miR-136 stem-loop
Gene family MIPF0000099; mir-136
Stem-loop
   uug   -        g        c     uuu          uuc 
5'    gau gagcccuc gaggacuc auuug   ugaugaugga   u
      ||| |||||||| |||||||| |||||   ||||||||||   u
3'    cua cuugggag cuucugag uaaac   gcuacuaccu   a
   -ua   u        a        -     ucu          cgu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163218898-163218989 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-136
mml-mir-431chr7: 163215205-163215318 [+]
mml-mir-433chr7: 163216084-163216176 [+]
mml-mir-127chr7: 163217177-163217273 [+]
mml-mir-432chr7: 163218684-163218777 [+]
mml-mir-136chr7: 163218898-163218989 [+]
Database links

Mature sequence mml-miR-136

Accession MIMAT0006192
Sequence

20 - 

acuccauuuguuuugaugaugga

 - 42

Get sequence
Evidence by similarity; MI0000475
Database links
Predicted targets

References

1