Stem-loop sequence mml-mir-136

Accession MI0007626
Description Macaca mulatta miR-136 stem-loop
Gene family MIPF0000099; mir-136
Stem-loop
   uug   -        g        c     uuu          uuc 
5'    gau gagcccuc gaggacuc auuug   ugaugaugga   u
      ||| |||||||| |||||||| |||||   ||||||||||   u
3'    cua cuugggag cuucugag uaaac   gcuacuaccu   a
   -ua   u        a        -     ucu          cgu 
Get sequence
Deep sequencing
7643 reads, 136 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164782532-164782623 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-136
mml-mir-431 chr7: 164778839-164778952 [+]
mml-mir-433 chr7: 164779718-164779810 [+]
mml-mir-127 chr7: 164780811-164780907 [+]
mml-mir-432 chr7: 164782318-164782411 [+]
mml-mir-136 chr7: 164782532-164782623 [+]
Database links

Mature sequence mml-miR-136

Accession MIMAT0006192
Sequence

20 - 

acuccauuuguuuugaugaugga

 - 42

Get sequence
Deep sequencing 223 reads, 8 experiments
Evidence by similarity; MI0000475
Predicted targets

References

1