Stem-loop sequence mml-mir-136

Accession MI0007626
Description Macaca mulatta miR-136 stem-loop
Gene family MIPF0000099; mir-136
Stem-loop
uug   -        g        c     uuu          uuc 
   gau gagcccuc gaggacuc auuug   ugaugaugga   u
   ||| |||||||| |||||||| |||||   ||||||||||   u
   cua cuugggag cuucugag uaaac   gcuacuaccu   a
-ua   u        a        -     ucu          cgu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164168644-164168735 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-136
mml-mir-665 7: 164158856-164158927 [+]
mml-mir-431 7: 164164951-164165064 [+]
mml-mir-433 7: 164165830-164165922 [+]
mml-mir-127 7: 164166923-164167019 [+]
mml-mir-432 7: 164168430-164168523 [+]
mml-mir-136 7: 164168644-164168735 [+]
Database links

Mature sequence mml-miR-136

Accession MIMAT0006192
Sequence

20 - 

acuccauuuguuuugaugaugga

 - 42

Get sequence
Evidence by similarity; MI0000475
Predicted targets

References

1