Stem-loop sequence mml-mir-135b

AccessionMI0007625 (change log)
DescriptionMacaca mulatta miR-135b stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   -------ca    -                   cau          --   cu 
5'          cucu gcuguggccuauggcuuuu   uccuauguga  uug  g
            |||| |||||||||||||||||||   ||||||||||  |||   
3'          ggga ugacaucggguaccgaaaa   gggauguacu  aac  u
   ccucgagcg    g                   -uc          ca   cc 
Get sequence
Deep sequencing
12029 reads, 44.4 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 161135771-161135867 [+]
intergenic
Database links

Mature sequence mml-miR-135b-5p

Accession MIMAT0006191
Sequence

16 - 

uauggcuuuucauuccuauguga

 - 38

Get sequence
Deep sequencing11578 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-135b-3p

Accession MIMAT0026820
Sequence

55 - 

auguagggcuaaaagccauggg

 - 76

Get sequence
Deep sequencing451 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).