Stem-loop sequence mml-mir-135b

Accession

MI0007625

Description

Macaca mulatta miR-135b stem-loop

Gene family

MIPF0000028; mir-135

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Stem-loop

-------ca    -                   cau          --   cu 
         cucu gcuguggccuauggcuuuu   uccuauguga  uug  g
         |||| |||||||||||||||||||   ||||||||||  |||   
         ggga ugacaucggguaccgaaaa   gggauguacu  aac  u
ccucgagcg    g                   -uc          ca   cc 

Genome context

• Coordinates (MMUL1.0): 1: 164970149-164970245 [+]
• Overlapping transcripts:

  intergenic

Database links

• ENTREZGENE: 100315198;MIR135B

Mature sequence mml-miR-135b

• Accession: MIMAT0006191
• Sequence: 16 - uauggcuuuucauuccuauguga - 38
• Evidence: by similarity; MI0000810
• Predicted targets:
  • TARGETSCAN-VERT:mml-miR-135b

References

1. PMID:18186931 "Identification of novel homologous microRNA genes in the rhesus macaque genome" Yue J, Sheng Y, Orwig KE BMC Genomics. 9:8(2008).