Stem-loop sequence mml-mir-135a-1

AccessionMI0007624
DescriptionMacaca mulatta miR-135a-1 stem-loop
Gene family MIPF0000028; mir-135
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a g         u u          uu            uucua 
 g ccucgcugu c cuauggcuuu  auuccuauguga     c
 | ||||||||| | ||||||||||  ||||||||||||     u
 c ggggcggca g ggugccgagg  uagggauauacu     g
a a         c c          -u            cacuc 
Get sequence
Deep sequencing
6295 reads, 125 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr6: 88235163-88235252 [+]
intergenic
Database links

Mature sequence mml-miR-135a-5p

Accession MIMAT0002251
Previous IDsmml-miR-135
Sequence

17 - 

uauggcuuuuuauuccuauguga

 - 39

Get sequence
Deep sequencing45 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-135a-1-3p

Accession MIMAT0031029
Sequence

55 - 

auauagggauuggagccguggc

 - 76

Get sequence
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).