Stem-loop sequence mml-mir-135a-1

AccessionMI0007624 (change log)
DescriptionMacaca mulatta miR-135a-1 stem-loop
Gene family MIPF0000028; mir-135
Literature search

1 open access papers mention mml-mir-135a-1
(2 sentences)

Stem-loop
   a g         u u          uu            uucua 
5'  g ccucgcugu c cuauggcuuu  auuccuauguga     c
    | ||||||||| | ||||||||||  ||||||||||||     u
3'  c ggggcggca g ggugccgagg  uagggauauacu     g
   a a         c c          -u            cacuc 
Get sequence
Deep sequencing
12655 reads, 44.4 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr2: 89922641-89922730 [+]
intergenic
Database links

Mature sequence mml-miR-135a-5p

Accession MIMAT0002251
Previous IDsmml-miR-135
Sequence

17 - 

uauggcuuuuuauuccuauguga

 - 39

Get sequence
Deep sequencing23863 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-135a-1-3p

Accession MIMAT0031029
Sequence

55 - 

auauagggauuggagccguggc

 - 76

Get sequence
Deep sequencing723 reads, 8 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).