Stem-loop sequence mml-mir-134

Accession MI0007623
Description Macaca mulatta miR-134 stem-loop
Gene family MIPF0000112; mir-134
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-134. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-134 is a family of microRNA precursors found in mammals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-134 precursor is the microRNA mir-134. miR-134 was one of a number of microRNAs found to be increasingly expressed in schizophrenia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c     gu        u  -a   g    gcgu  a 
 agggu  gugacugg ug  cca aggg    gc c
 |||||  |||||||| ||  ||| ||||    || u
 uccca  cacugauc ac  ggu uccc    ug g
c     ac        c  cg   g    -acu  u 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164338614-164338686 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-134
mml-mir-1185 7: 164328686-164328795 [+]
mml-mir-381 7: 164330417-164330491 [+]
mml-mir-487b 7: 164330952-164331035 [+]
mml-mir-539 7: 164331808-164331885 [+]
mml-mir-889 7: 164332385-164332463 [+]
mml-mir-544 7: 164333144-164333234 [+]
mml-mir-487a 7: 164336378-164336457 [+]
mml-mir-382 7: 164338233-164338308 [+]
mml-mir-134 7: 164338614-164338686 [+]
mml-mir-668 7: 164339183-164339248 [+]
mml-mir-485 7: 164339347-164339419 [+]
mml-mir-453 7: 164340111-164340190 [+]
mml-mir-154 7: 164343663-164343746 [+]
mml-mir-496 7: 164344514-164344615 [+]
mml-mir-377 7: 164345705-164345773 [+]
mml-mir-541 7: 164348143-164348226 [+]
Database links

Mature sequence mml-miR-134

Accession MIMAT0006190
Sequence

8 - 

ugugacugguugaccagagggg

 - 29

Get sequence
Evidence by similarity; MI0000474
Predicted targets

References

1