Stem-loop sequence mml-mir-134

AccessionMI0007623
DescriptionMacaca mulatta miR-134 stem-loop
Gene family MIPF0000112; mir-134
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-134. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-134 is a family of microRNA precursors found in mammals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-134 precursor is the microRNA mir-134. miR-134 was one of a number of microRNAs found to be increasingly expressed in schizophrenia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c     gu        u  -a   g    gcgu  a 
 agggu  gugacugg ug  cca aggg    gc c
 |||||  |||||||| ||  ||| ||||    || u
 uccca  cacugauc ac  ggu uccc    ug g
c     ac        c  cg   g    -acu  u 
Get sequence
Deep sequencing
2237 reads, 47.5 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164953119-164953191 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-134
mml-mir-381chr7: 164944340-164944414 [+]
mml-mir-487bchr7: 164944875-164944958 [+]
mml-mir-539chr7: 164945731-164945808 [+]
mml-mir-889chr7: 164946308-164946386 [+]
mml-mir-544chr7: 164947069-164947159 [+]
mml-mir-487achr7: 164950883-164950962 [+]
mml-mir-382chr7: 164952738-164952813 [+]
mml-mir-134chr7: 164953119-164953191 [+]
mml-mir-668chr7: 164953688-164953753 [+]
mml-mir-485chr7: 164953852-164953924 [+]
mml-mir-323bchr7: 164954659-164954715 [+]
mml-mir-154chr7: 164958168-164958251 [+]
mml-mir-496chr7: 164959019-164959120 [+]
mml-mir-377chr7: 164960414-164960482 [+]
mml-mir-541chr7: 164962858-164962941 [+]
Database links

Mature sequence mml-miR-134-5p

Accession MIMAT0006190
Sequence

8 - 

ugugacugguugaccagagggg

 - 29

Get sequence
Deep sequencing42 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-134-3p

Accession MIMAT0026819
Sequence

46 - 

ccugugggccaccuagucaccaa

 - 68

Get sequence
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).