Stem-loop sequence mml-mir-134

AccessionMI0007623 (change log)
DescriptionMacaca mulatta miR-134 stem-loop
Gene family MIPF0000112; mir-134
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-134. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-134 is a family of microRNA precursors found in mammals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-134 precursor is the microRNA mir-134. miR-134 was one of a number of microRNAs found to be increasingly expressed in schizophrenia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   c     gu        u  -a   g    gcgu  a 
5'  agggu  gugacugg ug  cca aggg    gc c
    |||||  |||||||| ||  ||| ||||    || u
3'  uccca  cacugauc ac  ggu uccc    ug g
   c     ac        c  cg   g    -acu  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163388701-163388773 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-134
mml-mir-381chr7: 163379925-163379999 [+]
mml-mir-487bchr7: 163380460-163380543 [+]
mml-mir-539chr7: 163381316-163381393 [+]
mml-mir-889chr7: 163381893-163381971 [+]
mml-mir-544chr7: 163382652-163382742 [+]
mml-mir-487achr7: 163386465-163386544 [+]
mml-mir-382chr7: 163388320-163388395 [+]
mml-mir-134chr7: 163388701-163388773 [+]
mml-mir-668chr7: 163389270-163389335 [+]
mml-mir-485chr7: 163389434-163389506 [+]
mml-mir-323bchr7: 163390241-163390297 [+]
mml-mir-154chr7: 163393750-163393833 [+]
mml-mir-496chr7: 163394601-163394702 [+]
mml-mir-377chr7: 163395850-163395918 [+]
mml-mir-541chr7: 163398288-163398371 [+]
Database links

Mature sequence mml-miR-134-5p

Accession MIMAT0006190
Sequence

8 - 

ugugacugguugaccagagggg

 - 29

Get sequence
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-134-3p

Accession MIMAT0026819
Sequence

46 - 

ccugugggccaccuagucaccaa

 - 68

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).