Stem-loop sequence mml-mir-133b

Accession MI0007622
Description Macaca mulatta miR-133b stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c   a  a  --aa  --    --       c        ca  c  a      u  g      
 cuc ga ga    ga  ugcc  cccugcu uggcuggu  aa gg accaag cc ucuuc 
 ||| || ||    ||  ||||  ||||||| ||||||||  || || |||||| || |||| c
 gag uu cu    cu  acgg  gggacga aucgacca  uu cc ugguuu gg agagu 
a   g  c  gacc  ua    uc       c        ac  c  c      -  -      
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
4: 51804247-51804365 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-133b
mml-mir-206 4: 51799701-51799786 [+]
mml-mir-133b 4: 51804247-51804365 [+]
Database links

Mature sequence mml-miR-133b

Accession MIMAT0006189
Sequence

66 - 

uuugguccccuucaaccagcua

 - 87

Get sequence
Evidence by similarity; MI0000822
Predicted targets

References

1