Stem-loop sequence mml-mir-133b

AccessionMI0007622 (change log)
DescriptionMacaca mulatta miR-133b stem-loop
Gene family MIPF0000029; mir-133
Literature search

2 open access papers mention mml-mir-133b
(2 sentences)

Stem-loop
   c   a  a  --aa  --    --       c        ca  c  a      u  g      
5'  cuc ga ga    ga  ugcc  cccugcu uggcuggu  aa gg accaag cc ucuuc 
    ||| || ||    ||  ||||  ||||||| ||||||||  || || |||||| || |||| c
3'  gag uu cu    cu  acgg  gggacga aucgacca  uu cc ugguuu gg agagu 
   a   g  c  gacc  ua    uc       c        ac  c  c      -  -      
Get sequence
Deep sequencing
24800 reads, 100 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr4: 53110676-53110794 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-133b
mml-mir-206chr4: 53106130-53106215 [+]
mml-mir-133bchr4: 53110676-53110794 [+]
Database links

Mature sequence mml-miR-133b-5p

Accession MIMAT0026818
Sequence

31 - 

uggucaaacggaaccaaguc

 - 50

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-133b-3p

Accession MIMAT0006189
Sequence

66 - 

uuugguccccuucaaccagcua

 - 87

Get sequence
Deep sequencing24798 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).