Stem-loop sequence mml-mir-133c

Accession MI0007621
Description Macaca mulatta miR-133c stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   g  a    --     uuu    g       aa  u  a        g cug 
5'  gg gcca  aaugc   gcua agcuggu  aa gg accaaauc a   u
    || ||||  |||||   |||| |||||||  || || |||||||| |    
3'  cc cggu  uuacg   cgau ucgacca  uu cc ugguuuag u   c
   g  g    ag     ugu    g       ac  c  c        g aac 
Get sequence
Deep sequencing
19634 reads, 313 reads per million, 8 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr10: 1816996-1817097 [-]
intergenic
Database links

Mature sequence mml-miR-133c-5p

Accession MIMAT0026817
Sequence

22 - 

agcugguaaaauggaaccaaau

 - 43

Get sequence
Deep sequencing 87 reads, 5 experiments
Evidence experimental; Illumina [2]

Mature sequence mml-miR-133c-3p

Accession MIMAT0006777
Sequence

59 - 

uuugguccccuucaaccagcug

 - 80

Get sequence
Deep sequencing 51 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).