Stem-loop sequence mml-mir-133c

AccessionMI0007621 (change log)
DescriptionMacaca mulatta miR-133c stem-loop
Gene family MIPF0000029; mir-133
Literature search

1 open access papers mention mml-mir-133c
(1 sentences)

Stem-loop
   g  a    --     uuu    g       aa  u  a        g cug 
5'  gg gcca  aaugc   gcua agcuggu  aa gg accaaauc a   u
    || ||||  |||||   |||| |||||||  || || |||||||| |    
3'  cc cggu  uuacg   cgau ucgacca  uu cc ugguuuag u   c
   g  g    ag     ugu    g       ac  c  c        g aac 
Get sequence
Deep sequencing
38368 reads, 100 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr10: 1797012-1797113 [-]
intergenic
Database links

Mature sequence mml-miR-133c-5p

Accession MIMAT0026817
Sequence

22 - 

agcugguaaaauggaaccaaau

 - 43

Get sequence
Deep sequencing3340 reads, 7 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-133c-3p

Accession MIMAT0006777
Sequence

59 - 

uuugguccccuucaaccagcug

 - 80

Get sequence
Deep sequencing34907 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).