Stem-loop sequence mml-mir-132

AccessionMI0007620 (change log)
DescriptionMacaca mulatta miR-132 stem-loop
Gene family MIPF0000065; mir-132
Literature search

2 open access papers mention mml-mir-132
(5 sentences)

Stem-loop
   c   cccc    -  c a    a         uuc          --gu g 
5'  cgc    gcgu cu c gggc accguggcu   gauuguuacu    g g
    |||    |||| || | |||| |||||||||   ||||||||||    |  
3'  gcg    cgca ga g cccg ugguaccga   cugacaaugg    c a
   c   cacc    c  c c    c         cau          aggu a 
Get sequence
Deep sequencing
84714 reads, 333 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 1943195-1943295 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-132
mml-mir-212chr16: 1943555-1943664 [-]
mml-mir-132chr16: 1943195-1943295 [-]
Database links

Mature sequence mml-miR-132-5p

Accession MIMAT0026816
Sequence

23 - 

accguggcuuucgauuguuacu

 - 44

Get sequence
Deep sequencing3867 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-132-3p

Accession MIMAT0006188
Sequence

59 - 

uaacagucuacagccauggucg

 - 80

Get sequence
Deep sequencing80819 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).