Stem-loop sequence mml-mir-130b

Accession MI0007619
Description Macaca mulatta miR-130b stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      c    ca       cc         a  guggg  a 
ggccug ccga  cucuuuc  uguugcacu cu     cc c
|||||| ||||  |||||||  ||||||||| ||     ||  
cuggac ggcu  gggaaag  guaacguga ga     gg u
      u    ac       ua         c  ----a  g 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
10: 65405642-65405723 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-130b
mml-mir-301b 10: 65405322-65405398 [+]
mml-mir-130b 10: 65405642-65405723 [+]
Database links

Mature sequence mml-miR-130b

Accession MIMAT0006187
Sequence

51 - 

cagugcaaugaugaaagggcau

 - 72

Get sequence
Evidence by similarity; MI0000748
Predicted targets

References

1