miRNA Entry for MI0007616

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-126. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-126

miR-126 precursor secondary structure and sequence conservation.
Identifiers
Symbol	mir-126
Rfam	RF00701
miRBase family	MIPF0000115
OMIM	611767
Other data
RNA type	microRNA
Domain(s)	Eukaryota;

In molecular biology mir-126 is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several pre- and post-transcription mechanisms. mir-126 is a human microRNA that is expressed only in endothelial cells, throughout capillaries as well as larger blood vessels,^[1] and acts upon various transcripts to control angiogenesis.^[2]

1 Genomic Location
2 mir-126*
3 Regulation of expression
4 Targets of mir-126
5 Involvement in homeostasis
6 Involvement in disease
7 See also
8 References
9 Further reading
10 External links

[edit] Genomic Location

miR-126 is located within the 7th intron of the EGFL7 gene which resides on human chromosome 9.^[3]

[edit] mir-126*

mir-126* is the complementary strand to mir-126 which forms once the double stranded pri-miRNA is cleaved and the two strands denature, separating. mir-126* is less abundantly found in organisms than mir-126 and fewer roles in regulating gene expression have been identified. However, mir-126* has recently been implicated in the silencing of prostien in non-endothelial cells. Prostein is able to be produced specifically in the prostate through the silencing of both mir-126* and EGFL7.^[4]

[edit] Regulation of expression

mir-126 is regulated by the binding of two transcription factors: ETS1 and ETS2.^[5] Binding of these factors induce the transcription of the mir-126 pre-miRNA resulting in the formation of the hairpin pri-miRNA. Hairpin miRNA is targeted to Dicer for cleavage, producing mature mir-126 and mir-126* transcripts.

Epigenetic regulation of the host gene by accumulation of methylation and gene silencing nucleosomes reduces expression of intronic miRNA affecting. This has been observed in cancers which benefit from the silencing of both EGFL7 and mir-126, resulting in neither being expressed.^[6]

Only one Single-nucleotide polymorphism within mir-126 has been identified. A change to the 24th base prevents the processing of the pri-miRNA into the mature miRNA, reducing the suppression of the various targets of mir-126.^[7] The frequency of the SNP varies between different ethnic backgrounds and potentially is related to the differential acquisition of human disease.

[edit] Targets of mir-126

miRNA binds to target sequences reducing the expression of the target gene. miRNA can bind either directly to DNA preventing transcription or to transcribed mRNA preventing translation and directing the mRNA for degradation. One of the main targets of mir-126 is the host gene EGFL7. Transcription of both occur, however mature mir-126 binds to a complementary sequence within EGFL7 preventing translation of the mRNA resulting in a decrease of EGFL7 protein levels.^[8] EGFL7 is known to be involved in cell migration and blood vessel formation,^[9] making EGFL7 and mir-126 opportune targets for disease, such as cancers, which require the continual formation of blood vessels to supply the tumour with nutrients and cell migration pathways to mediate tissue invasion.

CRK, a protein involved in intracellular signal pathways involved in regulating cellular adhesion, proliferation, migration and invasion.^[10]^[11]
TOM1 a negative regulator of the IL-1beta and TNF-alpha signalling pathways.^[12]
Production of CXCL12, a chemokine, is regulated by mir-126.^[13]
POU3F1, a factor required for the activation of the transcription factor PU.1. PU.1 negatively regulates GATA3 expression, altering the response of the T helper 2 cells.^[14]
VEGF-A protein production is reduced as mir-126 binds to the 3' untranslated region of the VEGF-A mRNA.^[15]
IRS-1 inhibiting the cell cycle from progressing from G₀/G₁into S phase.^[16]
HOXA9, mir-126 modulates HOXA9 expression in haematopoietic cells.^[17] HOX genes are important developmental regulatory genes.

[edit] Involvement in homeostasis

Tissue repair and maintenance are important parts of the life cycle of an organism, cells and tissues must remain in homeostasis to ensure survival. This includes controlled cell death and responses to wounds. During apoptosis cell death, cells release apoptotic bodies containing paracrine signals to neighbouring cells. In endothelial cells, mir-126 is also released with in these bodies are upon absorption in a neighbouring cell induce the CXCL12 dependant vascular protection.^[13] CXCL12 binds the receptor CXCR4 actively counteracting apoptosis and recruiting progenitor cells to the site of injury.

[edit] Involvement in disease

[edit] Cancer

mir-126 has been shown to be both a tumour suppressor and an oncogene depending on the type of cancer. Inhibition of cancer progression occurs through mir-126s negative control of proliferation, migration, invasion and cell survival, while mir-126 also may support cancer progression through the promotion of blood vessel formation and inflammation at the site of activation.^[3]

mir-126 and mir126* are overexpressed in acute myeloid leukemia.^[18]
mir-126 expression is reduced in colorectal cancer.^[19]
mir-126 expression is reduced in gastric cancer.^[10]
mir-126 expression is reduced in lung cancer cell lines.^[15]
mir-126 expression is reduced in prostate cancer^[6] and bladder cancer.^[6]
mir-126 expression is reduced in breast cancer.^[16] It also suppresses metastatic endothelial recruitment, angiogenesis and colonisation, through interaction with its target genes IGFBP2, PITPNC1, and MERTK. ^[20]
Increased expression of mir-126 inhibits cell proliferation of non-small cell lung carcinoma cells in vitro and prevents tomour growth through the targeting of EGFL7.^[9]

Recently, mir-126 has been used as a tumour marker in a non-invasive diagnostic testing method. Urine samples have been able to identify bladder cancer sufferers apart from those non-effected, as small RNAs are readily excreted through urine.^[21]

[edit] Diabetes

Low expression levels of many types of miRNA have been observed in type 2 diabetes including: mir-15a, mir-20b, mir-21, mir-124, mir-126, mir-191, mir-197, mir-223, mir-320 and mir-486.^[22] Increased expression of mir-28-3p has also been observed.^[22] The consequence of misregulation of these miRNAs has not been fully elucidated, however mir-126 has been shown to decrease in expression in response to high glucose levels.^[22] Interestingly the decrease of mir-15a, mir-29b, mir-126 and mir-223 proceedes the manifestation of the disease, making these transcripts a possible target for diagnostic testing for type 2 diabetes.

[edit] Cystic fibrosis

Comparisons of cystic fibrosis against non-cystic fibrosis airway epithelial cells shows that various miRNAs are differentially regulated in response to the disease. mir-126 is suspected to play a role in regulating the innate immune responses within Cystic Fibrosis affected lungs.^[12]

[edit] Allergic asthma

mir-126 increases the immune response to certain antigens resulting in overstimulation of the immune system and allergic asthma. T Helper 2 Cells are affected by mir-126 through a complicated interaction pathway, an increase in mir-126 results in an increase of the response of T Helper 2 Cells.^[14]

[edit] See also

[edit] References

^ van Solingen C, Seghers L, Bijkerk R, Duijs JM, Roeten MK, van Oeveren-Rietdijk AM, Baelde HJ, Monge M, Vos JB, de Boer HC, Quax PH, Rabelink TJ, van Zonneveld AJ (2009). "Antagomir-mediated silencing of endothelial cell specific microRNA-126 impairs ischemia-induced angiogenesis.". J Cell Mol Med 13 (8A): 1577–85. doi:10.1111/j.1582-4934.2008.00613.x. PMID 19120690.
^ Wang S, Aurora AB, Johnson BA, Qi X, McAnally J, Hill JA, Richardson JA, Bassel-Duby R, Olson EN (2008). "The endothelial-specific microRNA miR-126 governs vascular integrity and angiogenesis.". Dev Cell 15 (2): 261–71. doi:10.1016/j.devcel.2008.07.002. PMC 2685763. PMID 18694565. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2685763.
^ ^a ^b Meister J, Schmidt MH (2010). "miR-126 and miR-126*: new players in cancer.". ScientificWorldJournal 10: 2090–100. doi:10.1100/tsw.2010.198. PMID 20953557.
^ Musiyenko A, Bitko V, Barik S (2008). "Ectopic expression of miR-126*, an intronic product of the vascular endothelial EGF-like 7 gene, regulates prostein translation and invasiveness of prostate cancer LNCaP cells.". J Mol Med 86 (3): 313–22. doi:10.1007/s00109-007-0296-9. PMID 18193184.
^ Harris TA, Yamakuchi M, Kondo M, Oettgen P, Lowenstein CJ (2010). "Ets-1 and Ets-2 regulate the expression of microRNA-126 in endothelial cells.". Arterioscler Thromb Vasc Biol 30 (10): 1990–7. doi:10.1161/ATVBAHA.110.211706. PMID 20671229.
^ ^a ^b ^c Saito Y, Friedman JM, Chihara Y, Egger G, Chuang JC, Liang G (2009). "Epigenetic therapy upregulates the tumor suppressor microRNA-126 and its host gene EGFL7 in human cancer cells.". Biochem Biophys Res Commun 379 (3): 726–31. doi:10.1016/j.bbrc.2008.12.098. PMID 19116145.
^ Harnprasopwat R, Ha D, Toyoshima T, Lodish H, Tojo A, Kotani A (2010). "Alteration of processing induced by a single nucleotide polymorphism in pri-miR-126.". Biochem Biophys Res Commun 399 (2): 117–22. doi:10.1016/j.bbrc.2010.07.009. PMC 3056433. PMID 20621067. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3056433.
^ Sun YQ, Zhang F, Bai YF, Guo LL (2010). "[miR-126 modulates the expression of epidermal growth factor-like domain 7 in human umbilical vein endothelial cells in vitro]". Nan Fang Yi Ke Da Xue Xue Bao 30 (4): 767–70. PMID 20423846.
^ ^a ^b Sun Y, Bai Y, Zhang F, Wang Y, Guo Y, Guo L (2010). "miR-126 inhibits non-small cell lung cancer cells proliferation by targeting EGFL7". Biochem Biophys Res Commun 391 (3): 1483–9. doi:10.1016/j.bbrc.2009.12.098. PMID 20034472.
^ ^a ^b Feng R, Chen X, Yu Y, Su L, Yu B, Li J, Cai Q, Yan M, Liu B, Zhu Z (2010). "miR-126 functions as a tumour suppressor in human gastric cancer". Cancer Lett 298 (1): 50–63. doi:10.1016/j.canlet.2010.06.004. PMID 20619534.
^ Crawford M, Brawner E, Batte K, Yu L, Hunter MG, Otterson GA, Nuovo G, Marsh CB, Nana-Sinkam SP (2008). "MicroRNA-126 inhibits invasion in non-small cell lung carcinoma cell lines". Biochem Biophys Res Commun 373 (4): 607–12. doi:10.1016/j.bbrc.2008.06.090. PMID 18602365.
^ ^a ^b Oglesby IK, Bray IM, Chotirmall SH, Stallings RL, O'Neill SJ, McElvaney NG, Greene CM (2010). "miR-126 is downregulated in cystic fibrosis airway epithelial cells and regulates TOM1 expression". J Immunol 184 (4): 1702–9. doi:10.4049/jimmunol.0902669. PMID 20083669.
^ ^a ^b Zernecke A, Bidzhekov K, Noels H, Shagdarsuren E, Gan L, Denecke B, Hristov M, KÃ¶ppel T, Jahantigh MN, Lutgens E, Wang S, Olson EN, Schober A, Weber C (2009). "Delivery of microRNA-126 by apoptotic bodies induces CXCL12-dependent vascular protection". Sci Signal 2 (100): ra81. doi:10.1126/scisignal.2000610. PMID 19996457.
^ ^a ^b Mattes J, Collison A, Plank M, Phipps S, Foster PS (2009). "Antagonism of microRNA-126 suppresses the effector function of TH2 cells and the development of allergic airways disease". Proc Natl Acad Sci U S A 106 (44): 18704–9. doi:10.1073/pnas.0905063106. PMC 2773983. PMID 19843690. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2773983.
^ ^a ^b Liu B, Peng XC, Zheng XL, Wang J, Qin YW (2009). "MiR-126 restoration down-regulate VEGF and inhibit the growth of lung cancer cell lines in vitro and in vivo". Lung Cancer 66 (2): 169–75. doi:10.1016/j.lungcan.2009.01.010. PMID 19223090.
^ ^a ^b Zhang J, Du YY, Lin YF, Chen YT, Yang L, Wang HJ, Ma D (2008). "The cell growth suppressor, mir-126, targets IRS-1". Biochem Biophys Res Commun 377 (1): 136–40. doi:10.1016/j.bbrc.2008.09.089. PMID 18834857.
^ Shen WF, Hu YL, Uttarwar L, Passegue E, Largman C (2008). "MicroRNA-126 regulates HOXA9 by binding to the homeobox". Mol Cell Biol 28 (14): 4609–19. doi:10.1128/MCB.01652-07. PMC 2447122. PMID 18474618. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2447122.
^ Li Z, Chen J (2011). "In vitro functional study of miR-126 in leukemia". Methods Mol Biol 676: 185–95. doi:10.1007/978-1-60761-863-8_13. PMID 20931398.
^ Li XM, Wang AM, Zhang J, Yi H (2010). "Down-regulation of miR-126 expression in colorectal cancer and its clinical significance". Med Oncol. doi:10.1007/s12032-010-9637-6. PMID 20680522.
^ Png, K. J.; Halberg, N.; Yoshida, M.; Tavazoie, S. F. (2011). "A microRNA regulon that mediates endothelial recruitment and metastasis by cancer cells". Nature 481 (7380): 190–194. doi:10.1038/nature10661. PMID 22170610. edit
^ Hanke M, Hoefig K, Merz H, Feller AC, Kausch I, Jocham D, Warnecke JM, Sczakiel G (2009). "A robust methodology to study urine microRNA as tumor marker: microRNA-126 and microRNA-182 are related to urinary bladder cancer". Urol Oncol 28 (6): 655–61. doi:10.1016/j.urolonc.2009.01.027. PMID 19375957.
^ ^a ^b ^c Zampetaki A, Kiechl S, Drozdov I, Willeit P, Mayr U, Prokopi M, Mayr A, Weger S, Oberhollenzer F, Bonora E, Shah A, Willeit J, Mayr M (2010). "Plasma microRNA profiling reveals loss of endothelial miR-126 and other microRNAs in type 2 diabetes". Circ Res 107 (6): 810–7. doi:10.1161/CIRCRESAHA.110.226357. PMID 20651284.

[edit] Further reading

Kuhnert F, Mancuso MR, Hampton J, Stankunas K, Asano T, Chen CZ, Kuo CJ (2008). "Attribution of vascular phenotypes of the murine Egfl7 locus to the microRNA miR-126". Development 135 (24): 3989–93. doi:10.1242/dev.029736. PMID 18987025.
Fish JE, Santoro MM, Morton SU, Yu S, Yeh RF, Wythe JD, Ivey KN, Bruneau BG, Stainier DY, Srivastava D (2008). "miR-126 regulates angiogenic signaling and vascular integrity". Dev Cell 15 (2): 272–84. doi:10.1016/j.devcel.2008.07.008. PMC 2604134. PMID 18694566. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2604134.
Guo C, Sah JF, Beard L, Willson JK, Markowitz SD, Guda K (2008). "The noncoding RNA, miR-126, suppresses the growth of neoplastic cells by targeting phosphatidylinositol 3-kinase signaling and is frequently lost in colon cancers". Genes Chromosomes Cancer 47 (11): 939–46. doi:10.1002/gcc.20596. PMC 2739997. PMID 18663744. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2739997.
Harris TA, Yamakuchi M, Ferlito M, Mendell JT, Lowenstein CJ (2008). "MicroRNA-126 regulates endothelial expression of vascular cell adhesion molecule 1". Proc Natl Acad Sci U S A 105 (5): 1516–21. doi:10.1073/pnas.0707493105. PMC 2234176. PMID 18227515. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2234176.

[edit] External links

Rfam page for mir-126 microRNA precursor family

v t e miRNA precursor families

1-100	1 · 2 · 6 · 7 · 8/141/200 · 9/79 · 10 · 15 · 16 · 17 · 19 · 21 · 22 · 24 · 26 · 29 · 30 · 31 · 33 · 34 · 46/47/281 · 92 · 96

101-200	101 · 103/107 · 122 · 124 · 126 · 127 · 129 · 130 · 132 · 133 · 134 · 135 · 137 · 138 · 143 · 144 · 145 · 146 · 148/152 · 150 · 155 · 156 · 160 · 166 · 172 · 181 · 184 · 191 · 192/215 · 194 · 196 · 199 · 200

201+	203 · 205 · 208 · 210 · 214 · 218 · 219 · 221 · 223 · 224 · 296 · 338 · 395 · 399 · 433 · 451

Other	BART1 · BART2 · BHRF1-1 · BHRF1-2 · BHRF1-3 · Let-7 · Lin-4

Mature sequence mml-miR-126
Accession	MIMAT0006183
Sequence	52 - ucguaccgugaguaauaaugcg - 73 Get sequence
Evidence	by similarity; MI0000471
Predicted targets	TARGETSCAN-VERT:mml-miR-126

miRBase

Stem-loop sequence mml-mir-126

Contents