Stem-loop sequence mml-mir-124a-2

AccessionMI0007614 (change log)
DescriptionMacaca mulatta miR-124a-2 stem-loop
Gene family MIPF0000021; mir-124
Literature search

1 open access papers mention mml-mir-124a-2
(2 sentences)

Stem-loop
   a      uc   cc        a   ga        uaaau 
5'  ggccuc  ucu  guguucac gcg  ccuugauu     g
    ||||||  |||  |||||||| |||  ||||||||     u
3'  ucgggg  aga  cguaagug cgc  ggaauuaa     c
   g      ua   ac        g   ac        cauac 
Get sequence
Deep sequencing
618503 reads, 3.02e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr8: 9901066-9901150 [+]
intergenic
Database links

Mature sequence mml-miR-124a-5p

Accession MIMAT0026585
Sequence

17 - 

guucacagcggaccuugau

 - 35

Get sequence
Deep sequencing2984 reads, 8 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-124a-3p

Accession MIMAT0002470
Sequence

52 - 

uuaaggcacgcggugaaugcca

 - 73

Get sequence
Deep sequencing1233981 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).