Stem-loop sequence mml-mir-124a-2

Accession MI0007614
Description Macaca mulatta miR-124a-2 stem-loop
Gene family MIPF0000021; mir-124
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation. However these results are controversial since other reports have described a role for miR-124 during neuronal differentiation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a      uc   cc        a   ga        uaaau 
5'  ggccuc  ucu  guguucac gcg  ccuugauu     g
    ||||||  |||  |||||||| |||  ||||||||     u
3'  ucgggg  aga  cguaagug cgc  ggaauuaa     c
   g      ua   ac        g   ac        cauac 
Get sequence
Deep sequencing
67761 reads, 879 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr8: 10801801-10801885 [+]
intergenic
Database links

Mature sequence mml-miR-124a-5p

Accession MIMAT0026585
Sequence

17 - 

guucacagcggaccuugau

 - 35

Get sequence
Deep sequencing 2 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence mml-miR-124a-3p

Accession MIMAT0002470
Sequence

52 - 

uuaaggcacgcggugaaugcca

 - 73

Get sequence
Deep sequencing 924 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).