Stem-loop sequence mml-mir-124a-2

Accession MI0007614
Description Macaca mulatta miR-124a-2 stem-loop
Gene family MIPF0000021; mir-124
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a      uc   cc        a   ga        uaaau 
 ggccuc  ucu  guguucac gcg  ccuugauu     g
 ||||||  |||  |||||||| |||  ||||||||     u
 ucgggg  aga  cguaagug cgc  ggaauuaa     c
g      ua   ac        g   ac        cauac 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
8: 10818292-10818376 [+]
intergenic
Database links

Mature sequence mml-miR-124a

Accession MIMAT0002470
Sequence

52 - 

uuaaggcacgcggugaaugcca

 - 73

Get sequence
Evidence by similarity; MI0000443
Predicted targets

References

1