Stem-loop sequence mml-mir-122a

Accession MI0007613
Description Macaca mulatta miR-122a stem-loop
Gene family MIPF0000095; mir-122
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-122. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-122 is a miRNA that is conserved between vertebrate species. miR-122 is not present in invertebrates, and no close paralogs of miR-122 have been detected. miR-122 expression is specific to the liver, where it has been implicated as a regulator of fatty-acid metabolism in mouse studies. Reduced miR-122 levels are associated with hepatocellular carcinoma. miR-122 also plays an important positive role in the regulation of hepatitis C virus replication.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c     c  -      gg       c           --u  c 
 cuuag ag agcugu  aguguga aaugguguuug   gu u
 ||||| || ||||||  ||||||| |||||||||||   ||  
 ggauc uc ucgaua  ucacacu uuaccgcaaac   ca a
c     a  a      aa       a           uau  a 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
18: 51716504-51716588 [+]
intergenic
Database links

Mature sequence mml-miR-122a

Accession MIMAT0006180
Sequence

15 - 

uggagugugacaaugguguuug

 - 36

Get sequence
Evidence by similarity; MI0000442
Predicted targets

References

1