Stem-loop sequence mml-mir-122a

AccessionMI0007613 (change log)
DescriptionMacaca mulatta miR-122a stem-loop
Gene family MIPF0000095; mir-122
Literature search

4 open access papers mention mml-mir-122a
(11 sentences)

Stem-loop
   c     c  -      gg       c           --u  c 
5'  cuuag ag agcugu  aguguga aaugguguuug   gu u
    ||||| || ||||||  ||||||| |||||||||||   ||  
3'  ggauc uc ucgaua  ucacacu uuaccgcaaac   ca a
   c     a  a      aa       a           uau  a 
Get sequence
Deep sequencing
15799 reads, 66.7 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr18: 47923530-47923614 [+]
intergenic
Database links

Mature sequence mml-miR-122a-5p

Accession MIMAT0006180
Sequence

15 - 

uggagugugacaaugguguuug

 - 36

Get sequence
Deep sequencing15771 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-122a-3p

Accession MIMAT0026813
Sequence

52 - 

acgccauuaucacacuaaaua

 - 72

Get sequence
Deep sequencing24 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).