Stem-loop sequence mml-mir-105-2

AccessionMI0007612 (change log)
DescriptionMacaca mulatta miR-105-2 stem-loop
Gene family MIPF0000074; mir-105
Stem-loop
   ugu         u  a          uc        g ug 
5'    gcaucgugg ca augcucagac  cuguggug c  c
      ||||||||| || ||||||||||  |||||||| |  u
3'    ugugguauc gu uacgaguuug  ggcaccac g  u
   auc         -  g          ua        - ua 
Get sequence
Deep sequencing
8338 reads, 37.5 reads per million, 8 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 146011639-146011719 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-105-2
mml-mir-105-2chrX: 146011639-146011719 [-]
mml-mir-767chrX: 146010639-146010748 [-]
mml-mir-105-1chrX: 146009447-146009527 [-]
Database links

Mature sequence mml-miR-105-5p

Accession MIMAT0002454
Sequence

13 - 

ucaaaugcucagacuccuguggu

 - 35

Get sequence
Deep sequencing16154 reads, 8 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-105-3p

Accession MIMAT0026583
Sequence

51 - 

acggauguuugagcaugugcua

 - 72

Get sequence
Deep sequencing520 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).