Stem-loop sequence mml-mir-105-2

Accession MI0007612
Description Macaca mulatta miR-105-2 stem-loop
Gene family MIPF0000074; mir-105
Stem-loop
ugu         u  a          uc        g ug 
   gcaucgugg ca augcucagac  cuguggug c  c
   ||||||||| || ||||||||||  |||||||| |  u
   ugugguauc gu uacgaguuug  ggcaccac g  u
auc         -  g          ua        - ua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 150475738-150475818 [-]
sense
ENSMMUT00000002176 ; MMU.3820-201; intron 1
Clustered miRNAs
< 10kb from mml-mir-105-2
mml-mir-105-2 X: 150475738-150475818 [-]
mml-mir-767 X: 150474738-150474847 [-]
mml-mir-105-1 X: 150473546-150473626 [-]
Database links

Mature sequence mml-miR-105-5p

Accession MIMAT0002454
Sequence

13 - 

ucaaaugcucagacuccuguggu

 - 35

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-105-3p

Accession MIMAT0026583
Sequence

51 - 

acggauguuugagcaugugcua

 - 72

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).