Stem-loop sequence mml-mir-103-2

Accession MI0007611
Description Macaca mulatta miR-103-2 stem-loop
Gene family MIPF0000024; mir-103
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-103/107_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes. mir-103 has also been linked with chronic pain and intestinal cell proliferation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
uu  g      --   u  u           ----    ua 
  gu cuuuca  gcu cu uacagugcugc    cuug  g
  || ||||||  ||| || |||||||||||    ||||  c
  ca gaaagu  cgg ga auguuacgacg    ggac  a
ac  a      au   -  c           aacu    uu 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
10: 37253045-37253122 [+]
sense
Database links

Mature sequence mml-miR-103

Accession MIMAT0002447
Sequence

48 - 

agcagcauuguacagggcuauga

 - 70

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1