Stem-loop sequence mml-mir-101-2

AccessionMI0007610 (change log)
DescriptionMacaca mulatta miR-101-2 stem-loop
Gene family MIPF0000046; mir-101
Literature search

1 open access papers mention mml-mir-101-2
(1 sentences)

Stem-loop
     ug  c                    c a    guaua 
5' ac  uc uuuuucgguuaucaugguac g ugcu     u
   ||  || |||||||||||||||||||| | ||||      
3' ug  gg aagaagucaauagugucaug c augg     c
     gu  u                    a -    aaagu 
Get sequence
Deep sequencing
3447192 reads, 2.14e+04 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr15: 79649338-79649416 [-]
intergenic
Database links

Mature sequence mml-miR-101-2-5p

Accession MIMAT0031100
Sequence

12 - 

ucgguuaucaugguaccgaugcu

 - 34

Get sequence
Deep sequencing15 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-101-3p

Accession MIMAT0002431
Sequence

49 - 

uacaguacugugauaacugaag

 - 70

Get sequence
Deep sequencing6891688 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).