Stem-loop sequence mml-mir-99b

AccessionMI0007609 (change log)
DescriptionMacaca mulatta miR-99b stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
        cc         ac   c    c - -   c 
5' ggcac  acccguaga  cga cuug g g ggc u
   |||||  |||||||||  ||| |||| | | |||  
3' cugug  ugggugucu  gcu gaac c c ccg u
        cc         gu   c    a a g   c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 46927837-46927906 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-99b
mml-mir-99bchr19: 46927837-46927906 [+]
mml-let-7echr19: 46928012-46928090 [+]
mml-mir-125achr19: 46928481-46928566 [+]
Database links

Mature sequence mml-miR-99b-5p

Accession MIMAT0006179
Sequence

7 - 

cacccguagaaccgaccuugcg

 - 28

Get sequence
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-99b-3p

Accession MIMAT0026812
Sequence

46 - 

aagcucgugucuguggguccg

 - 66

Get sequence
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).