|
miRBase |
|
Stem-loop sequence mml-mir-99b |
||||||||
| Accession | MI0007609 | |||||||
| Description | Macaca mulatta miR-99b stem-loop | |||||||
| Gene family | MIPF0000025; mir-99 | |||||||
| Stem-loop |
cc ac c c - - c ggcac acccguaga cga cuug g g ggc u ||||| ||||||||| ||| |||| | | ||| cugug ugggugucu gcu gaac c c ccg u cc gu c a a g c |
|||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
| Database links |
|
|||||||
Mature sequence mml-miR-99b |
|
| Accession | MIMAT0006179 |
| Sequence |
7 - cacccguagaaccgaccuugcg - 28 |
| Evidence | by similarity; MI0000746 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|