Stem-loop sequence mml-mir-99b

Accession MI0007609
Description Macaca mulatta miR-99b stem-loop
Gene family MIPF0000025; mir-99
Stem-loop
     cc         ac   c    c - -   c 
ggcac  acccguaga  cga cuug g g ggc u
|||||  |||||||||  ||| |||| | | |||  
cugug  ugggugucu  gcu gaac c c ccg u
     cc         gu   c    a a g   c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 57750860-57750929 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-99b
mml-mir-99b 19: 57750860-57750929 [+]
mml-let-7e 19: 57751035-57751113 [+]
mml-mir-125a 19: 57751504-57751589 [+]
Database links

Mature sequence mml-miR-99b-5p

Accession MIMAT0006179
Sequence

7 - 

cacccguagaaccgaccuugcg

 - 28

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-99b-3p

Accession MIMAT0026812
Sequence

46 - 

aagcucgugucuguggguccg

 - 66

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).