Stem-loop sequence mml-mir-95

Accession MI0007608
Description Macaca mulatta miR-95 stem-loop
Gene family MIPF0000098; mir-95
Stem-loop
a   c      ca          gu         -   aa 
 aca aguggg  cucaauaaau  cuguugaau uga  u
 ||| ||||||  ||||||||||  ||||||||| |||   
 ugu ucaccc  gaguuauuua  ggcaacuua auu  g
g   c      ac          ug         c   gc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
5: 771296-771376 [+]
sense
ENSMMUT00000019633 ; ABLIM2-203; intron 14
ENSMMUT00000019630 ; ABLIM2-202; intron 15
Database links

Mature sequence mml-miR-95-5p

Accession MIMAT0026811
Sequence

15 - 

ucaauaaaugucuguugaauu

 - 35

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-95-3p

Accession MIMAT0006178
Sequence

49 - 

uucaacggguauuuauugagca

 - 70

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).