Stem-loop sequence mml-mir-95

AccessionMI0007608
DescriptionMacaca mulatta miR-95 stem-loop
Gene family MIPF0000098; mir-95
Stem-loop
a   c      ca          gu         -   aa 
 aca aguggg  cucaauaaau  cuguugaau uga  u
 ||| ||||||  ||||||||||  ||||||||| |||   
 ugu ucaccc  gaguuauuua  ggcaacuua auu  g
g   c      ac          ug         c   gc 
Get sequence
Deep sequencing
44147 reads, 699 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr5: 972485-972565 [+]
intergenic
Database links

Mature sequence mml-miR-95-5p

Accession MIMAT0026811
Sequence

15 - 

ucaauaaaugucuguugaauu

 - 35

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence mml-miR-95-3p

Accession MIMAT0006178
Sequence

49 - 

uucaacggguauuuauugagca

 - 70

Get sequence
Deep sequencing318 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).