Stem-loop sequence mml-mir-92b

Accession MI0007607
Description Macaca mulatta miR-92b stem-loop
Gene family MIPF0000013; mir-25
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-92_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-92 microRNAs are short single stranded non-protein coding RNA fragments initially discovered incorporated into an RNP complex with a proposed role of processing RNA molecules and further RNP assembly. Mir-92 has been mapped to the human genome as part of a larger cluster at chromosome 13q31.3, where it is 22 nucleotides in length but exists in the genome as part of a longer precursor sequence. There is an exact replica of the mir-92 precursor on the X chromosome. MicroRNAs are endogenous triggers of the RNAi pathway which involves several ribonucleic proteins (RNPs) dedicated to repressing mRNA molecules via translation inhibition and/or induction of mRNA cleavage. miRNAs are themselves matured from their long RNA precursors by ribonucleic proteins as part of a 2 step biogenesis mechanism involving RNA polymerase 2. Most miRNAs are grouped into clusters in the human genome or within families that share functions, expression profiles, promotors, or are incorporated into the same ribonucleic protein. The purpose of having a variety of miRNAs in a single peace of RNA processing machinery is to act as complementary strands to the recognition elements of a variety of target RNA molecules. The recognition elements of target mRNAs are typically within the 3' untranslated regions and with 678 human miRNAs and 472 mouse miRNAs confidently identified so far (miRBASE) there are extensive efforts taking place using bioinformatics tools to scan genomes for potential recognition elements for families of miRNAs in order to identify potential target genes. Mir-92 is no exception and currently identified gene targets have been among those involved in cell cycle regulation and cell signalling, and thus necessary during all stages of mammalian development and essential for the proliferation of cells. miRNAs can be oncogenes or tumor suppressor genes depending on their targets while mir-92 has been implicated as the former in leukaemia forms AML and ALL, Hepatocellular carcinoma (HCC) and several other cancers. The search for non invasive tools for diagnosis and management of cancer is extremely important for reducing the world wide health burden of cancer. miRNAs show potential as biomarkers and can even be found circulating in the serum. Some circulating miRNAs are specific to tumour patients, while miR-92 on the other-hand is present in healthy individuals in the serum but levels are variable and appear to change in response to the onset of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c     cc   c    g     ga       c            uucuu 
 gggcc  ggg gggc ggagg  cgggacg ggugcaguguug     u
 |||||  ||| |||| |||||  ||||||| ||||||||||||     c
 cccgg  ccc cccg ccucc  gcccugc ucacguuauaac     c
-     -c   -    g     -g       -            cgccc 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
1: 133744543-133744638 [+]
intergenic
Database links

Mature sequence mml-miR-92b

Accession MIMAT0006177
Sequence

61 - 

uauugcacucgucccggccucc

 - 82

Get sequence
Evidence by similarity; MI0003560
Predicted targets

References

1