Stem-loop sequence mml-mir-34c

Accession MI0007605
Description Macaca mulatta miR-34c stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network of proteins; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     ag     a   a    a     c      c  a 
agucu  uuacc ggc gugu guuag ugauug ug u
|||||  ||||| ||| |||| ||||| |||||| ||  
uuaga  aaugg ccg caca caauc acuaac au a
     aa     a   g    c     -      c  g 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
14: 109970674-109970750 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-34c
mml-mir-34b 14: 109970171-109970254 [+]
mml-mir-34c 14: 109970674-109970750 [+]
Database links

Mature sequence mml-miR-34c-5p

Accession MIMAT0006175
Sequence

13 - 

aggcaguguaguuagcugauugc

 - 35

Get sequence
Evidence by similarity; MI0000743
Predicted targets

Mature sequence mml-miR-34c-3p

Accession MIMAT0006176
Sequence

46 - 

aaucacuaaccacacggccagg

 - 67

Get sequence
Evidence by similarity; MI0000743
Predicted targets

References

1