Stem-loop sequence mml-mir-34b

Accession MI0007604
Description Macaca mulatta miR-34b stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network of proteins; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     cg    -gua       uca    c        -  g 
gugcu  guuu    ggcagug   uuag ugauugua cu u
|||||  ||||    |||||||   |||| |||||||| || g
cacgg  caaa    ccgucac   aauc acuaacau gg g
     aa    acua       cuc    -        u  u 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
14: 109970171-109970254 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-34b
mml-mir-34b 14: 109970171-109970254 [+]
mml-mir-34c 14: 109970674-109970750 [+]
Database links

Mature sequence mml-miR-34b

Accession MIMAT0006174
Sequence

50 - 

caaucacuaacuccacugccau

 - 71

Get sequence
Evidence by similarity; MI0000742
Predicted targets

References

1