Stem-loop sequence mml-mir-33b

Accession MI0007603
Description Macaca mulatta miR-33b stem-loop
Gene family MIPF0000070; mir-33
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-33. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-33 is a family of microRNA precursors, which are processed by the Dicer enzyme to give mature microRNAs. miR-33 is found in several animal species, including humans. In some species there is a single member of this family which gives the mature product mir-33. In humans there are two members of this family called mir-33a and mir-33b, which are located in intronic regions within two protein-coding genes for Sterol regulatory element-binding proteins (SREBP-2 and SREBP-1) respectively.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
---------gcggg    c   c  -          uu         g   g 
              cggc ccg gg ugcauugcug  gcauugcac ugu u
              |||| ||| || ||||||||||  ||||||||| ||| g
              gccg ggc cc acgugacggc  cgugacgug gcg a
cgccacgguccccg    a   -  g          uc         g   g 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
16: 17718310-17718405 [-]
sense
Database links

Mature sequence mml-miR-33b

Accession MIMAT0006173
Sequence

16 - 

gugcauugcuguugcauugc

 - 35

Get sequence
Evidence by similarity; MI0003646
Predicted targets

References

1