Stem-loop sequence mml-mir-33b

AccessionMI0007603 (change log)
DescriptionMacaca mulatta miR-33b stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   ---------gcggg    c   c  -          uu         g   g 
5'               cggc ccg gg ugcauugcug  gcauugcac ugu u
                 |||| ||| || ||||||||||  ||||||||| ||| g
3'               gccg ggc cc acgugacggc  cgugacgug gcg a
   cgccacgguccccg    a   -  g          uc         g   g 
Get sequence
Deep sequencing
1395 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 17953778-17953873 [-]
intergenic
Database links

Mature sequence mml-miR-33b-5p

Accession MIMAT0006173
Sequence

16 - 

gugcauugcuguugcauugc

 - 35

Get sequence
Deep sequencing1362 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-33b-3p

Accession MIMAT0026808
Sequence

56 - 

gugccucggcagugcagccc

 - 75

Get sequence
Deep sequencing25 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).