Stem-loop sequence mml-mir-33b

AccessionMI0007603
DescriptionMacaca mulatta miR-33b stem-loop
Gene family MIPF0000070; mir-33
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-33. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-33 is a family of microRNA precursors, which are processed by the Dicer enzyme to give mature microRNAs. miR-33 is found in several animal species, including humans. In some species there is a single member of this family which gives the mature product mir-33. In humans there are two members of this family called mir-33a and mir-33b, which are located in intronic regions within two protein-coding genes for Sterol regulatory element-binding proteins (SREBP-2 and SREBP-1) respectively.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
---------gcggg    c   c  -          uu         g   g 
              cggc ccg gg ugcauugcug  gcauugcac ugu u
              |||| ||| || ||||||||||  ||||||||| ||| g
              gccg ggc cc acgugacggc  cgugacgug gcg a
cgccacgguccccg    a   -  g          uc         g   g 
Get sequence
Deep sequencing
1080 reads, 17.9 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr16: 18447006-18447101 [-]
intergenic
Database links

Mature sequence mml-miR-33b-5p

Accession MIMAT0006173
Sequence

16 - 

gugcauugcuguugcauugc

 - 35

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-33b-3p

Accession MIMAT0026808
Sequence

56 - 

gugccucggcagugcagccc

 - 75

Get sequence
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).