Stem-loop sequence mml-mir-30e

AccessionMI0007602 (change log)
DescriptionMacaca mulatta miR-30e stem-loop
Gene family MIPF0000005; mir-30
Literature search

3 open access papers mention mml-mir-30e
(5 sentences)

Stem-loop
   g        uc  ua            uu           g aag u 
5'  ggcagucu  gc  cuguaaacaucc  gacuggaagcu u   g g
    ||||||||  ||  ||||||||||||  ||||||||||| |   |  
3'  ccgucgga  cg  gacauuuguagg  cugacuuucga g   c u
   a        --  gc            --           g aga u 
Get sequence
Deep sequencing
9207215 reads, 6.22e+04 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 40059281-40059372 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-30e
mml-mir-30echr1: 40059281-40059372 [+]
mml-mir-30c-1chr1: 40062235-40062323 [+]
Database links

Mature sequence mml-miR-30e-5p

Accession MIMAT0006172
Sequence

17 - 

uguaaacauccuugacuggaag

 - 38

Get sequence
Deep sequencing8449100 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-30e-3p

Accession MIMAT0026807
Sequence

60 - 

uuucagucggauguuuacagc

 - 80

Get sequence
Deep sequencing758112 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).