Stem-loop sequence mml-mir-30e

Accession MI0007602
Description Macaca mulatta miR-30e stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
g        uc  ua            uu           g aag u 
 ggcagucu  gc  cuguaaacaucc  gacuggaagcu u   g g
 ||||||||  ||  ||||||||||||  ||||||||||| |   |  
 ccgucgga  cg  gacauuuguagg  cugacuuucga g   c u
a        --  gc            --           g aga u 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
1: 43635963-43636054 [+]
sense
Clustered miRNAs
< 10kb from mml-mir-30e
mml-mir-30e 1: 43635963-43636054 [+]
mml-mir-30c-1 1: 43638917-43639005 [+]
Database links

Mature sequence mml-miR-30e

Accession MIMAT0006172
Sequence

17 - 

uguaaacauccuugacuggaag

 - 38

Get sequence
Evidence by similarity; MI0000749
Predicted targets

References

1