Stem-loop sequence mml-mir-30d

AccessionMI0007601 (change log)
DescriptionMacaca mulatta miR-30d stem-loop
Gene family MIPF0000005; mir-30
Literature search

2 open access papers mention mml-mir-30d
(5 sentences)

Stem-loop
   -uu  u         ccc           gua  ac 
5'    gu guaaacauc   gacuggaagcu   ag  a
      || |||||||||   |||||||||||   ||   
3'    cg cguuuguag   cugacuuucga   uc  c
   cau  u         --a           --a  ga 
Get sequence
Deep sequencing
9632501 reads, 6.38e+04 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr8: 134099791-134099859 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-30d
mml-mir-30dchr8: 134099791-134099859 [-]
mml-mir-30bchr8: 134094376-134094463 [-]
Database links

Mature sequence mml-miR-30d-5p

Accession MIMAT0006171
Sequence

5 - 

uguaaacauccccgacuggaag

 - 26

Get sequence
Deep sequencing9191012 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-30d-3p

Accession MIMAT0026806
Sequence

46 - 

uuucagucagauguuugcugc

 - 66

Get sequence
Deep sequencing441477 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).