Stem-loop sequence mml-mir-30d

AccessionMI0007601
DescriptionMacaca mulatta miR-30d stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-uu  u         ccc           gua  ac 
   gu guaaacauc   gacuggaagcu   ag  a
   || |||||||||   |||||||||||   ||   
   cg cguuuguag   cugacuuucga   uc  c
cau  u         --a           --a  ga 
Get sequence
Deep sequencing
547442 reads, 9.75e+03 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr8: 139769629-139769697 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-30d
mml-mir-30dchr8: 139769629-139769697 [-]
mml-mir-30bchr8: 139764211-139764298 [-]
Database links

Mature sequence mml-miR-30d-5p

Accession MIMAT0006171
Sequence

5 - 

uguaaacauccccgacuggaag

 - 26

Get sequence
Deep sequencing1111 reads, 8 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-30d-3p

Accession MIMAT0026806
Sequence

46 - 

uuucagucagauguuugcugc

 - 66

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).