Stem-loop sequence mml-mir-30c-2

AccessionMI0007600 (change log)
DescriptionMacaca mulatta miR-30c-2 stem-loop
Gene family MIPF0000005; mir-30
Literature search

2 open access papers mention mml-mir-30c-2
(7 sentences)

Stem-loop
      uacu       u   aca         guggaa 
5' aga    guaaaca ccu   cucucagcu      a
   |||    ||||||| |||   |||||||||       
3' ucu    cauuugu gga   gagggucga      g
      cucu       c   --a         aagaau 
Get sequence
Deep sequencing
241209 reads, 1.33e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr4: 69440027-69440098 [-]
intergenic
Database links

Mature sequence mml-miR-30c-5p

Accession MIMAT0006170
Sequence

7 - 

uguaaacauccuacacucucagc

 - 29

Get sequence
Deep sequencing419015 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-30c-2-3p

Accession MIMAT0031117
Sequence

48 - 

ugggagaaggcuguuuacucu

 - 68

Get sequence
Deep sequencing31608 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).