Stem-loop sequence mml-mir-30c-2

Accession MI0007600
Description Macaca mulatta miR-30c-2 stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   uacu       u   aca         guggaa 
aga    guaaaca ccu   cucucagcu      a
|||    ||||||| |||   |||||||||       
ucu    cauuugu gga   gagggucga      g
   cucu       c   --a         aagaau 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
4: 67679469-67679540 [-]
sense
Database links

Mature sequence mml-miR-30c

Accession MIMAT0006170
Sequence

7 - 

uguaaacauccuacacucucagc

 - 29

Get sequence
Evidence by similarity; MI0000254
Predicted targets

References

1