Stem-loop sequence mml-mir-30c-1

AccessionMI0007599 (change log)
DescriptionMacaca mulatta miR-30c-1 stem-loop
Gene family MIPF0000005; mir-30
Literature search

2 open access papers mention mml-mir-30c-1
(7 sentences)

Stem-loop
   a     cu    ugu u       u   aca         ---g  a 
5'  ccaug  guag   g guaaaca ccu   cucucagcu    ug g
    |||||  ||||   | ||||||| |||   |||||||||    ||  
3'  gguac  cguc   c cauuugu ggg   gagggucgg    ac c
   a     --    uuc u       u   --a         ugga  u 
Get sequence
Deep sequencing
211376 reads, 1.17e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 40062235-40062323 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-30c-1
mml-mir-30echr1: 40059281-40059372 [+]
mml-mir-30c-1chr1: 40062235-40062323 [+]
Database links

Mature sequence mml-miR-30c-5p

Accession MIMAT0006170
Sequence

17 - 

uguaaacauccuacacucucagc

 - 39

Get sequence
Deep sequencing419015 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-30c-1-3p

Accession MIMAT0026805
Sequence

57 - 

ugggagaggguuguuuacucc

 - 77

Get sequence
Deep sequencing1870 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).