Stem-loop sequence mml-mir-29c

AccessionMI0007598 (change log)
DescriptionMacaca mulatta miR-29c stem-loop
Gene family MIPF0000009; mir-29
Literature search

3 open access papers mention mml-mir-29c
(3 sentences)

Stem-loop
   a         -  ggc           ucc       ---     u 
5'  ucucuuaca ca   ugaccgauuuc   ugguguu   cagag c
    ||||||||| ||   |||||||||||   |||||||   ||||| u
3'  gggggaugu gu   auuggcuaaag   accacga   guuuu g
   a         a  ---           uuu       ucu     u 
Get sequence
Deep sequencing
820125 reads, 4.69e+03 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 158780300-158780387 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-29c
mml-mir-29b-2chr1: 158779716-158779796 [+]
mml-mir-29cchr1: 158780300-158780387 [+]
Database links

Mature sequence mml-miR-29c-5p

Accession MIMAT0026804
Sequence

19 - 

ccgauuucuccugguguucag

 - 39

Get sequence
Deep sequencing3952 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-29c-3p

Accession MIMAT0006169
Sequence

54 - 

uagcaccauuugaaaucgguua

 - 75

Get sequence
Deep sequencing816158 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).