Stem-loop sequence mml-mir-29c

Accession MI0007598
Description Macaca mulatta miR-29c stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a         -  ggc           ucc       ---     u 
5'  ucucuuaca ca   ugaccgauuuc   ugguguu   cagag c
    ||||||||| ||   |||||||||||   |||||||   ||||| u
3'  gggggaugu gu   auuggcuaaag   accacga   guuuu g
   a         a  ---           uuu       ucu     u 
Get sequence
Deep sequencing
495319 reads, 7.93e+03 reads per million, 8 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr1: 163153877-163153964 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-29c
mml-mir-29b-2 chr1: 163153293-163153373 [+]
mml-mir-29c chr1: 163153877-163153964 [+]
Database links

Mature sequence mml-miR-29c-5p

Accession MIMAT0026804
Sequence

19 - 

ccgauuucuccugguguucag

 - 39

Get sequence
Deep sequencing 13 reads, 6 experiments
Evidence experimental; Illumina [2]

Mature sequence mml-miR-29c-3p

Accession MIMAT0006169
Sequence

54 - 

uagcaccauuugaaaucgguua

 - 75

Get sequence
Deep sequencing 2161 reads, 8 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).