Stem-loop sequence mml-mir-29b-2

AccessionMI0007597 (change log)
DescriptionMacaca mulatta miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
            -          c      g  u    uuuucc 
5' cuucuggaa gcugguuuca auggug cu agau      a
   ||||||||| |||||||||| |||||| || ||||       
3' gaggauuuu ugacuaaagu uaccac ga ucua      u
            g          u      -  -    uguuuc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 158779716-158779796 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-29b-2
mml-mir-29b-2chr1: 158779716-158779796 [+]
mml-mir-29cchr1: 158780300-158780387 [+]
Database links

Mature sequence mml-miR-29b-2-5p

Accession MIMAT0031079
Sequence

9 - 

agcugguuucacaugguggcuuaga

 - 33

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-29b-3p

Accession MIMAT0006168
Sequence

52 - 

uagcaccauuugaaaucaguguu

 - 74

Get sequence
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).