Stem-loop sequence mml-mir-29b-2

Accession MI0007597
Description Macaca mulatta miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
         -          c      g  u    uuuucc 
cuucuggaa gcugguuuca auggug cu agau      a
||||||||| |||||||||| |||||| || ||||       
gaggauuuu ugacuaaagu uaccac ga ucua      u
         g          u      -  -    uguuuc 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
1: 162574142-162574222 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-29b-2
mml-mir-29b-2 1: 162574142-162574222 [+]
mml-mir-29c 1: 162574726-162574813 [+]
Database links

Mature sequence mml-miR-29b

Accession MIMAT0006168
Sequence

52 - 

uagcaccauuugaaaucaguguu

 - 74

Get sequence
Evidence by similarity; MI0000107
Predicted targets

References

1