Stem-loop sequence mml-mir-29b-1

Accession MI0007596
Description Macaca mulatta miR-29b-1 stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-         -          u      gu      uuaaa 
 cuucaggaa gcugguuuca auggug  uuagau     u
 ||||||||| |||||||||| ||||||  ||||||     a
 gggguucuu ugacuaaagu uaccac  gaucug     g
g         g          u      --      uuagu 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
3: 168265278-168265358 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-29b-1
mml-mir-29b-1 3: 168265278-168265358 [-]
mml-mir-29a 3: 168264566-168264629 [-]
Database links

Mature sequence mml-miR-29b

Accession MIMAT0006168
Sequence

51 - 

uagcaccauuugaaaucaguguu

 - 73

Get sequence
Evidence by similarity; MI0000105
Predicted targets

References

1