Stem-loop sequence mml-mir-29b-1

AccessionMI0007596 (change log)
DescriptionMacaca mulatta miR-29b-1 stem-loop
Gene family MIPF0000009; mir-29
Literature search

5 open access papers mention mml-mir-29b-1
(12 sentences)

Stem-loop
   -         -          u      gu      uuaaa 
5'  cuucaggaa gcugguuuca auggug  uuagau     u
    ||||||||| |||||||||| ||||||  ||||||     a
3'  gggguucuu ugacuaaagu uaccac  gaucug     g
   g         g          u      --      uuagu 
Get sequence
Deep sequencing
327727 reads, 1.84e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 157003735-157003815 [-]
sense
ENSMMUT00000007228 ; PLXNA4-201; intron 1
ENSMMUT00000041772 ; PLXNA4-202; intron 3
Clustered miRNAs
< 10kb from mml-mir-29b-1
mml-mir-29b-1chr3: 157003735-157003815 [-]
mml-mir-29achr3: 157003023-157003086 [-]
Database links

Mature sequence mml-miR-29b-1-5p

Accession MIMAT0026803
Sequence

9 - 

agcugguuucauauggugguuuaga

 - 33

Get sequence
Deep sequencing4725 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-29b-3p

Accession MIMAT0006168
Sequence

51 - 

uagcaccauuugaaaucaguguu

 - 73

Get sequence
Deep sequencing646264 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).