Stem-loop sequence mml-mir-27b

Accession MI0007595
Description Macaca mulatta miR-27b stem-loop
Gene family MIPF0000036; mir-27
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-27. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-    -    aaca                  auug        ugau     
 accu cucu    aggugcagagcuuagcug    gugaacag    uggu 
 |||| ||||    ||||||||||||||||||    ||||||||    ||| u
 ugga gaga    uccacgucuugaaucggu    cacuuguu    gccu 
g    a    --ag                  --ga        --uc     
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
15: 106898933-106899029 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-27b
mml-mir-23b 15: 106898696-106898792 [+]
mml-mir-27b 15: 106898933-106899029 [+]
mml-mir-24-1 15: 106899505-106899572 [+]
Database links

Mature sequence mml-miR-27b

Accession MIMAT0006167
Sequence

61 - 

uucacaguggcuaaguucugc

 - 81

Get sequence
Evidence by similarity; MI0000440
Predicted targets

References

1