Stem-loop sequence mml-mir-27b

AccessionMI0007595 (change log)
DescriptionMacaca mulatta miR-27b stem-loop
Gene family MIPF0000036; mir-27
Stem-loop
   -    -    aaca                  auug        ugau     
5'  accu cucu    aggugcagagcuuagcug    gugaacag    uggu 
    |||| ||||    ||||||||||||||||||    ||||||||    ||| u
3'  ugga gaga    uccacgucuugaaucggu    cacuuguu    gccu 
   g    a    --ag                  --ga        --uc     
Get sequence
Deep sequencing
933799 reads, 5.3e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr15: 108904304-108904400 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-27b
mml-mir-23bchr15: 108904067-108904163 [+]
mml-mir-27bchr15: 108904304-108904400 [+]
mml-mir-24-1chr15: 108904876-108904943 [+]
Database links

Mature sequence mml-miR-27b-5p

Accession MIMAT0026802
Sequence

19 - 

agagcuuagcugauuggugaaca

 - 41

Get sequence
Deep sequencing10705 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-27b-3p

Accession MIMAT0006167
Sequence

61 - 

uucacaguggcuaaguucugc

 - 81

Get sequence
Deep sequencing923073 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).