Stem-loop sequence mml-mir-26b

AccessionMI0007594 (change log)
DescriptionMacaca mulatta miR-26b stem-loop
Gene family MIPF0000043; mir-26
Literature search

1 open access papers mention mml-mir-26b
(2 sentences)

Stem-loop
       ga   -   u        uc           u ug 
5' ccgg  ccc agu caaguaau  aggauagguug g  c
   ||||  ||| ||| ||||||||  ||||||||||| |   
3' ggcc  ggg ucg guucauua  ucuuguccgac c  u
       ag   c   -        cc           - ug 
Get sequence
Deep sequencing
777426 reads, 5.13e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr12: 100509522-100509598 [+]
sense
ENSMMUT00000032116 ; PNKD-202; intron 2
Database links

Mature sequence mml-miR-26b-5p

Accession MIMAT0006166
Sequence

12 - 

uucaaguaauucaggauaggu

 - 32

Get sequence
Deep sequencing776807 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-26b-3p

Accession MIMAT0026801
Sequence

47 - 

ccuguucuccauuacuuggcu

 - 67

Get sequence
Deep sequencing420 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).