Stem-loop sequence mml-mir-26a-2

AccessionMI0007593 (change log)
DescriptionMacaca mulatta miR-26a-2 stem-loop
Gene family MIPF0000043; mir-26
Literature search

3 open access papers mention mml-mir-26a-2
(7 sentences)

Stem-loop
         gg ug  uu         c          guuucc 
5' ggcugu  c  ga  caaguaauc aggauaggcu      a
   ||||||  |  ||  ||||||||| ||||||||||       
3' ucgacg  g  cu  guucauuag ucuuauccgg      u
         ga gu  uu         u          aguguc 
Get sequence
Deep sequencing
884457 reads, 5.49e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr11: 56631054-56631137 [-]
intergenic
Database links

Mature sequence mml-miR-26a-5p

Accession MIMAT0002349
Sequence

14 - 

uucaaguaauccaggauaggcu

 - 35

Get sequence
Deep sequencing1768705 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-26a-2-3p

Accession MIMAT0031062
Sequence

52 - 

ccuauucuugauuacuuguuuc

 - 73

Get sequence
Deep sequencing45 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).