|
miRBase |
|
Stem-loop sequence mml-mir-23b |
||||||||
| Accession | MI0007592 | |||||||
| Description | Macaca mulatta miR-23b stem-loop | |||||||
| Gene family | MIPF0000027; mir-23 | |||||||
| Stem-loop |
c u c - c u -- - c gugacu ucagg g uc ugg ugc ugg guuccuggca ug ugauuu u ||||| | || ||| ||| ||| |||||||||| || |||||| gguuc c ag acc acg acc uagggaccgu ac acuaaa a c - - c a c au u - auuaga |
|||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
| Database links |
|
|||||||
Mature sequence mml-miR-23b |
|
| Accession | MIMAT0006165 |
| Sequence |
58 - aucacauugccagggauuacc - 78 |
| Evidence | by similarity; MI0000439 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|