Stem-loop sequence mml-mir-23b

Accession MI0007592
Description Macaca mulatta miR-23b stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
c     u c  -   c   u   --          -  c      gugacu 
 ucagg g uc ugg ugc ugg  guuccuggca ug ugauuu      u
 ||||| | || ||| ||| |||  |||||||||| || ||||||       
 gguuc c ag acc acg acc  uagggaccgu ac acuaaa      a
c     - -  c   a   c   au          u  -      auuaga 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
15: 106898696-106898792 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-23b
mml-mir-23b 15: 106898696-106898792 [+]
mml-mir-27b 15: 106898933-106899029 [+]
mml-mir-24-1 15: 106899505-106899572 [+]
Database links

Mature sequence mml-miR-23b-5p

Accession MIMAT0026800
Sequence

21 - 

ggguuccuggcaugcugauuu

 - 41

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-23b-3p

Accession MIMAT0006165
Sequence

58 - 

aucacauugccagggauuacc

 - 78

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).