Stem-loop sequence mml-mir-23b

AccessionMI0007592 (change log)
DescriptionMacaca mulatta miR-23b stem-loop
Gene family MIPF0000027; mir-23
Literature search

3 open access papers mention mml-mir-23b
(3 sentences)

Stem-loop
   c     u c  -   c   u   --          -  c      gugacu 
5'  ucagg g uc ugg ugc ugg  guuccuggca ug ugauuu      u
    ||||| | || ||| ||| |||  |||||||||| || ||||||       
3'  gguuc c ag acc acg acc  uagggaccgu ac acuaaa      a
   c     - -  c   a   c   au          u  -      auuaga 
Get sequence
Deep sequencing
189041 reads, 911 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr15: 108904067-108904163 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-23b
mml-mir-23bchr15: 108904067-108904163 [+]
mml-mir-27bchr15: 108904304-108904400 [+]
mml-mir-24-1chr15: 108904876-108904943 [+]
Database links

Mature sequence mml-miR-23b-5p

Accession MIMAT0026800
Sequence

21 - 

ggguuccuggcaugcugauuu

 - 41

Get sequence
Deep sequencing285 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-23b-3p

Accession MIMAT0006165
Sequence

58 - 

aucacauugccagggauuacc

 - 78

Get sequence
Deep sequencing188727 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).