Stem-loop sequence mml-mir-18b

AccessionMI0007590 (change log)
DescriptionMacaca mulatta miR-18b stem-loop
Gene family MIPF0000001; mir-17
Literature search

4 open access papers mention mml-mir-18b
(7 sentences)

Stem-loop
   ug     --   u    c   u     ua  --g     
5'   uguua  agg gcau uag gcagu  gu   aagc 
     |||||  ||| |||| ||| |||||  ||   ||| a
3'   acggu  ucc cgua auc cguca  ua   uucg 
   --     cu   c    a   c     uc  aga     
Get sequence
Deep sequencing
2759 reads, 11.1 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 128132396-128132466 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-18b
mml-mir-106achrX: 128132553-128132633 [-]
mml-mir-18bchrX: 128132396-128132466 [-]
mml-mir-20bchrX: 128132164-128132232 [-]
mml-mir-19b-2chrX: 128132026-128132121 [-]
mml-mir-92a-2chrX: 128131893-128131967 [-]
mml-mir-363chrX: 128131733-128131807 [-]
Database links

Mature sequence mml-miR-18b

Accession MIMAT0006163
Sequence

6 - 

uaaggugcaucuagugcaguuag

 - 28

Get sequence
Deep sequencing2753 reads, 9 experiments
Evidence by similarity; MI0001518
Predicted targets

References

1