Stem-loop sequence mml-mir-16-2

AccessionMI0007589 (change log)
DescriptionMacaca mulatta miR-16-2 stem-loop
Gene family MIPF0000006; mir-15
Literature search

3 open access papers mention mml-mir-16-2
(4 sentences)

Stem-loop
     uc    cu         ua        c  ag   aau 
5' gu  cacu  agcagcacg  aauauugg gu  uga   a
   ||  ||||  |||||||||  |||||||| ||  |||    
3' ca  guga  ucgucgugu  uuauaacc ca  auu   u
     gu    cu         ca        a  -a   aug 
Get sequence
Deep sequencing
130916 reads, 889 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr2: 134308544-134308624 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-16-2
mml-mir-15bchr2: 134308684-134308781 [-]
mml-mir-16-2chr2: 134308544-134308624 [-]
Database links

Mature sequence mml-miR-16-5p

Accession MIMAT0002651
Sequence

10 - 

uagcagcacguaaauauuggcg

 - 31

Get sequence
Deep sequencing260352 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-16-2-3p

Accession MIMAT0031018
Sequence

53 - 

ccaauauuacugugcugcuuca

 - 74

Get sequence
Deep sequencing731 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).