Stem-loop sequence mml-mir-10b

AccessionMI0007588 (change log)
DescriptionMacaca mulatta miR-10b stem-loop
Gene family MIPF0000033; mir-10
Literature search

2 open access papers mention mml-mir-10b
(4 sentences)

Stem-loop
   cca      guaa     u        a    g     c          -ug   u 
5'    gagguu    cguug cuauauau cccu uagaa cgaauuugug   gua c
      ||||||    ||||| |||||||| |||| ||||| ||||||||||   |||  
3'    cuucaa    guagc gguauaua gggg aucuu gcuuagacac   uau c
   --a      aaac     u        a    -     a          uga   a 
Get sequence
Deep sequencing
4868903 reads, 4.14e+04 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr12: 63173247-63173356 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-10b
mml-mir-7164chr12: 63172852-63172901 [+]
mml-mir-10bchr12: 63173247-63173356 [+]
Database links

Mature sequence mml-miR-10b-5p

Accession MIMAT0006162
Sequence

27 - 

uacccuguagaaccgaauuugug

 - 49

Get sequence
Deep sequencing4867596 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-10b-3p

Accession MIMAT0026798
Sequence

68 - 

agauucgauucuaggggaaua

 - 88

Get sequence
Deep sequencing1288 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).