Stem-loop sequence mml-mir-10b

Accession MI0007588
Description Macaca mulatta miR-10b stem-loop
Gene family MIPF0000033; mir-10
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-10_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-10 microRNA precursor is a short non-coding RNA gene involved in gene regulation. It is part of an RNA gene family which contains miR-10, miR-51, miR-57, miR-99 and miR-100. miR-10, miR-99 and miR-100 have now been predicted or experimentally confirmed in a wide range of species. (MIPF0000033, MIPF0000025) mir-51 and mir-57 have currently only been identified in the nematode Caenorhabditis elegans (MIPF0000268, MIPF0000271). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
cca      guaa     u        a    g     c          -ug   u 
   gagguu    cguug cuauauau cccu uagaa cgaauuugug   gua c
   ||||||    ||||| |||||||| |||| ||||| ||||||||||   |||  
   cuucaa    guagc gguauaua gggg aucuu gcuuagacac   uau c
--a      aaac     u        a    -     a          uga   a 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
12: 39792044-39792153 [+]
intergenic
Database links

Mature sequence mml-miR-10b

Accession MIMAT0006162
Sequence

27 - 

uacccuguagaaccgaauuugug

 - 49

Get sequence
Evidence by similarity; MI0000267
Predicted targets

References

1